Incidental Mutation 'R4778:Tmem43'
ID426214
Institutional Source Beutler Lab
Gene Symbol Tmem43
Ensembl Gene ENSMUSG00000030095
Gene Nametransmembrane protein 43
Synonyms1200015A22Rik, LUMA
MMRRC Submission 042414-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4778 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location91473703-91488463 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 91482255 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 236 (V236A)
Ref Sequence ENSEMBL: ENSMUSP00000032183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032183]
Predicted Effect probably damaging
Transcript: ENSMUST00000032183
AA Change: V236A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032183
Gene: ENSMUSG00000030095
AA Change: V236A

DomainStartEndE-ValueType
transmembrane domain 32 51 N/A INTRINSIC
Pfam:DUF1625 121 373 3.6e-88 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144246
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153179
Meta Mutation Damage Score 0.7506 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the TMEM43 family. Defects in this gene are the cause of familial arrhythmogenic right ventricular dysplasia type 5 (ARVD5), also known as arrhythmogenic right ventricular cardiomyopathy type 5 (ARVC5). Arrhythmogenic right ventricular dysplasia is an inherited disorder, often involving both ventricles, and is characterized by ventricular tachycardia, heart failure, sudden cardiac death, and fibrofatty replacement of cardiomyocytes. This gene contains a response element for PPAR gamma (an adipogenic transcription factor), which may explain the fibrofatty replacement of the myocardium, a characteristic pathological finding in ARVC. [provided by RefSeq, Oct 2008]
PHENOTYPE: In a gihg-throughput screen, female homozygous mutant mice exhibited an increased anxiety-like response during open field activity testing when compared with their gender-matched wild-type littermates and the historical mean. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610037L13Rik T C 4: 107,891,998 V64A probably damaging Het
4932438A13Rik T A 3: 36,937,065 M897K possibly damaging Het
Abcc10 T C 17: 46,304,416 N1349S probably damaging Het
AF529169 T A 9: 89,603,102 I81F probably damaging Het
Ahnak T C 19: 9,011,975 V3541A possibly damaging Het
Arhgap33 T A 7: 30,532,093 T156S probably benign Het
Card11 G T 5: 140,883,782 probably null Het
Cdh3 T A 8: 106,543,826 I445N probably damaging Het
Csrp3 T G 7: 48,832,563 K169N probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Dpysl3 C T 18: 43,354,802 V159I probably benign Het
Erc1 A T 6: 119,797,337 probably null Het
Fat1 T C 8: 45,038,326 V3808A probably benign Het
Fbxw19 T C 9: 109,494,646 D87G probably damaging Het
Gm1123 T C 9: 99,018,507 I99V probably benign Het
Gm11677 C T 11: 111,724,711 noncoding transcript Het
Gm5045 T A 15: 59,211,403 noncoding transcript Het
Hand1 T C 11: 57,831,623 D55G possibly damaging Het
Lrguk T A 6: 34,056,080 I227K probably damaging Het
Mdn1 C T 4: 32,683,583 R726* probably null Het
Myo16 T A 8: 10,569,694 V1415E probably damaging Het
Myof T C 19: 37,949,563 D901G probably damaging Het
Naip1 A G 13: 100,426,648 Y670H probably damaging Het
Nmd3 T A 3: 69,731,591 Y171* probably null Het
Notch4 C T 17: 34,582,511 A1111V possibly damaging Het
Nphp4 T A 4: 152,556,291 D1038E probably benign Het
Olfr484 A T 7: 108,124,480 I261N possibly damaging Het
Olfr694 A C 7: 106,689,667 S21R probably damaging Het
Osbpl10 C T 9: 115,109,530 S86L probably damaging Het
Pcsk6 G A 7: 65,959,145 G252R probably damaging Het
Pole T G 5: 110,330,832 H15Q probably benign Het
Pstpip1 A G 9: 56,128,620 D383G possibly damaging Het
Ptprq T C 10: 107,591,022 T1551A probably benign Het
Rasgrf2 A G 13: 91,983,661 F626L probably damaging Het
Retreg1 C A 15: 25,971,785 N394K possibly damaging Het
Rpp14 T A 14: 8,090,203 D42E probably benign Het
Rrp8 T A 7: 105,737,274 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Snx1 T C 9: 66,101,416 probably benign Het
Stau1 A T 2: 166,963,522 N51K probably benign Het
Tdrd5 T A 1: 156,255,587 D960V probably damaging Het
Tex10 T C 4: 48,436,468 D750G probably damaging Het
Tmem89 T C 9: 108,915,375 V112A probably damaging Het
Traf7 C G 17: 24,510,438 probably benign Het
Vmn1r41 A C 6: 89,747,275 K266T probably damaging Het
Vmn2r65 T C 7: 84,943,593 K469E possibly damaging Het
Zfp831 A G 2: 174,646,807 T1092A possibly damaging Het
Zfp981 T A 4: 146,537,655 S346T probably benign Het
Other mutations in Tmem43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02887:Tmem43 APN 6 91477374 missense possibly damaging 0.73
IGL03105:Tmem43 APN 6 91480700 missense probably damaging 1.00
R0415:Tmem43 UTSW 6 91482318 missense probably benign 0.13
R1388:Tmem43 UTSW 6 91478803 splice site probably null
R1581:Tmem43 UTSW 6 91478735 missense probably benign 0.01
R1777:Tmem43 UTSW 6 91477330 nonsense probably null
R1895:Tmem43 UTSW 6 91486909 missense probably benign 0.31
R1946:Tmem43 UTSW 6 91486909 missense probably benign 0.31
R2697:Tmem43 UTSW 6 91479929 missense possibly damaging 0.85
R5205:Tmem43 UTSW 6 91486781 missense possibly damaging 0.89
R5366:Tmem43 UTSW 6 91478258 missense probably benign 0.43
R5383:Tmem43 UTSW 6 91473890 missense probably benign 0.00
R5516:Tmem43 UTSW 6 91478210 missense possibly damaging 0.70
R5569:Tmem43 UTSW 6 91477354 missense probably benign 0.01
R5656:Tmem43 UTSW 6 91480708 missense probably benign 0.01
R6490:Tmem43 UTSW 6 91478777 missense probably damaging 0.97
R6490:Tmem43 UTSW 6 91486880 missense possibly damaging 0.91
R7853:Tmem43 UTSW 6 91481986 missense probably benign 0.06
R8330:Tmem43 UTSW 6 91478764 missense possibly damaging 0.94
S24628:Tmem43 UTSW 6 91482318 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AGAGGCCATGGCTTTTCAG -3'
(R):5'- TTGGGGCAGATCTACACAGG -3'

Sequencing Primer
(F):5'- TCAGTGTGTGCAGCAGC -3'
(R):5'- GCCTTCTGAAAGTGCCCAAGAG -3'
Posted On2016-08-25