Incidental Mutation 'R4809:Fn1'
ID426226
Institutional Source Beutler Lab
Gene Symbol Fn1
Ensembl Gene ENSMUSG00000026193
Gene Namefibronectin 1
SynonymsFn-1, Fn
MMRRC Submission 042428-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4809 (G1)
Quality Score130
Status Validated
Chromosome1
Chromosomal Location71585520-71653200 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to A at 71652800 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055226] [ENSMUST00000186129] [ENSMUST00000186736] [ENSMUST00000186940] [ENSMUST00000187938] [ENSMUST00000188674] [ENSMUST00000188894] [ENSMUST00000189821] [ENSMUST00000190780]
Predicted Effect probably benign
Transcript: ENSMUST00000055226
SMART Domains Protein: ENSMUSP00000054499
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1264 1346 4.22e-9 SMART
FN3 1357 1437 9.6e-13 SMART
FN3 1448 1527 1.82e-13 SMART
FN3 1538 1617 6.69e-12 SMART
FN3 1632 1711 2.72e-12 SMART
FN3 1722 1801 8.9e-8 SMART
FN3 1812 1891 1.66e-7 SMART
FN3 1904 1983 4.92e-10 SMART
FN3 1993 2074 3.64e-13 SMART
low complexity region 2148 2165 N/A INTRINSIC
FN3 2193 2272 2.9e0 SMART
FN1 2296 2340 3.72e-19 SMART
FN1 2341 2383 2.49e-20 SMART
FN1 2385 2425 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000097699
SMART Domains Protein: ENSMUSP00000095305
Gene: ENSMUSG00000073652

DomainStartEndE-ValueType
low complexity region 40 67 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127218
Predicted Effect probably benign
Transcript: ENSMUST00000186129
SMART Domains Protein: ENSMUSP00000141123
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1967 1984 N/A INTRINSIC
FN3 2012 2091 2.9e0 SMART
FN1 2115 2159 3.72e-19 SMART
FN1 2160 2202 2.49e-20 SMART
FN1 2204 2244 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186736
SMART Domains Protein: ENSMUSP00000140372
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN1 53 96 3.3e-21 SMART
FN1 98 142 1.7e-21 SMART
Pfam:fn1 143 160 1.2e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186879
Predicted Effect probably benign
Transcript: ENSMUST00000186940
SMART Domains Protein: ENSMUSP00000140315
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 1.77e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187938
SMART Domains Protein: ENSMUSP00000140975
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2032 2049 N/A INTRINSIC
FN3 2077 2156 2.9e0 SMART
FN1 2180 2224 3.72e-19 SMART
FN1 2225 2267 2.49e-20 SMART
FN1 2269 2309 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188674
SMART Domains Protein: ENSMUSP00000140907
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1981 6.79e-13 SMART
FN3 1983 2061 1.01e1 SMART
FN1 2085 2129 3.72e-19 SMART
FN1 2130 2172 2.49e-20 SMART
FN1 2174 2214 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188894
SMART Domains Protein: ENSMUSP00000140471
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2057 2074 N/A INTRINSIC
FN3 2102 2181 2.9e0 SMART
FN1 2205 2249 3.72e-19 SMART
FN1 2250 2292 2.49e-20 SMART
FN1 2294 2334 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189821
SMART Domains Protein: ENSMUSP00000139702
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1891 6.79e-13 SMART
FN3 1893 1971 1.01e1 SMART
FN1 1995 2039 3.72e-19 SMART
FN1 2040 2082 2.49e-20 SMART
FN1 2084 2124 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190780
SMART Domains Protein: ENSMUSP00000140816
Gene: ENSMUSG00000026193

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1942 1959 N/A INTRINSIC
FN3 1987 2066 2.9e0 SMART
FN1 2090 2134 3.72e-19 SMART
FN1 2135 2177 2.49e-20 SMART
FN1 2179 2219 2.69e-16 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes fibronectin, a glycoprotein present in a soluble dimeric form in plasma, and in a dimeric or multimeric form at the cell surface and in extracellular matrix. The encoded preproprotein is proteolytically processed to generate the mature protein. Fibronectin is involved in cell adhesion and migration processes including embryogenesis, wound healing, blood coagulation, host defense, and metastasis. The gene has three regions subject to alternative splicing, with the potential to produce 20 different transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. The full-length nature of some variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants are defective in mesodermal function. Null mutants are embryonic lethal with major patterning and organizational defects. Conditional mutants live and show increased neuronal apoptosis and susceptibility to induced cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,662,631 V459A probably benign Het
Abca12 C T 1: 71,278,856 A1840T probably benign Het
Abhd6 T G 14: 8,039,771 M1R probably null Het
Abl1 T C 2: 31,800,242 L572P probably damaging Het
Adamts2 C A 11: 50,803,690 S1101R probably benign Het
Adgra2 G A 8: 27,110,479 W200* probably null Het
AI661453 C A 17: 47,467,187 probably benign Het
Aldh1l2 A G 10: 83,506,632 F438S probably damaging Het
Ankrd49 G A 9: 14,781,214 T218I possibly damaging Het
Ano7 T C 1: 93,394,566 F410L probably benign Het
Aox4 T A 1: 58,266,649 F1271I probably damaging Het
Aqr T C 2: 114,175,214 probably benign Het
Arhgap42 A G 9: 9,180,117 S54P probably damaging Het
Aunip C A 4: 134,511,139 D16E possibly damaging Het
Btbd7 A G 12: 102,793,744 probably null Het
Cabp4 T C 19: 4,139,291 H89R probably benign Het
Ccni AAA AAACTAA 5: 93,187,570 probably benign Het
Chfr C T 5: 110,158,834 H410Y probably damaging Het
Churc1 C A 12: 76,782,897 L111M probably damaging Het
Clasp1 C T 1: 118,461,250 T113I probably benign Het
Col12a1 T A 9: 79,693,567 Q745L probably benign Het
Col20a1 T C 2: 180,998,661 L537P probably damaging Het
Creb5 A T 6: 53,610,426 E47V probably null Het
Csnk1d A T 11: 120,963,842 probably benign Het
Cts6 A T 13: 61,202,181 W29R probably damaging Het
Dbt T A 3: 116,546,343 I420N probably damaging Het
Det1 C A 7: 78,843,807 D150Y probably damaging Het
Dlk2 A G 17: 46,299,014 probably null Het
Dnmt3a A T 12: 3,900,352 I639F probably damaging Het
Dock9 A T 14: 121,546,596 Y1989N probably benign Het
Dsg4 A T 18: 20,466,621 T765S possibly damaging Het
Epha5 C T 5: 84,105,891 D548N possibly damaging Het
Fam189a1 G A 7: 64,776,740 T159I probably damaging Het
Fam227b T A 2: 126,116,125 Y240F possibly damaging Het
Fbxw21 C T 9: 109,143,390 V395I probably damaging Het
Fpr-rs3 A T 17: 20,624,421 S153T probably benign Het
Frem2 A G 3: 53,653,895 F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gjd2 C T 2: 114,011,541 G152R probably damaging Het
Gpr75 T C 11: 30,892,154 I353T possibly damaging Het
Grb7 T C 11: 98,451,436 V145A possibly damaging Het
Igkv4-73 G A 6: 69,197,823 R40W unknown Het
Kif1c C T 11: 70,726,357 A839V probably benign Het
Krt31 G A 11: 100,049,922 A125V possibly damaging Het
Lamb1 A G 12: 31,278,526 Y163C probably damaging Het
Mars G T 10: 127,300,215 T535K probably damaging Het
Mdc1 T C 17: 35,849,101 probably null Het
Micu1 C T 10: 59,740,822 H167Y probably benign Het
Minos1 C G 4: 139,130,957 W10S probably damaging Het
Mrgprb1 C T 7: 48,447,991 V58I possibly damaging Het
Ncoa7 T A 10: 30,771,762 E6V possibly damaging Het
Nectin3 A C 16: 46,448,160 probably benign Het
Olfr1085 T A 2: 86,657,685 M258L possibly damaging Het
Olfr1294 C T 2: 111,537,611 C226Y probably benign Het
Olfr46 A G 7: 140,611,074 K295E probably damaging Het
Olfr598 T A 7: 103,328,523 Y12* probably null Het
Pex16 T C 2: 92,376,638 S54P probably damaging Het
Pik3cg A T 12: 32,204,081 S636T possibly damaging Het
Plin5 A G 17: 56,116,855 S27P probably benign Het
Ptch1 A T 13: 63,513,708 D1068E probably damaging Het
Ptprq T C 10: 107,563,175 T1960A probably damaging Het
Rap1gap2 T C 11: 74,407,974 probably benign Het
Rcc2 G A 4: 140,717,042 R348Q probably damaging Het
Rhbdd3 C A 11: 5,105,949 A377D probably damaging Het
Rpl7 T G 1: 16,101,965 probably benign Het
Scn11a G T 9: 119,819,870 D42E probably benign Het
Scube3 C T 17: 28,165,173 R549W probably damaging Het
Sil1 A T 18: 35,325,375 M189K probably damaging Het
Slc39a6 G A 18: 24,585,474 Q225* probably null Het
Slc7a15 A T 12: 8,539,002 C182S probably benign Het
Spata21 G A 4: 141,097,120 probably null Het
Stim2 T C 5: 54,110,613 V417A probably damaging Het
Szt2 T C 4: 118,388,985 D993G probably damaging Het
Tet3 A G 6: 83,402,946 S747P probably benign Het
Tmem86a C G 7: 47,052,930 S34R possibly damaging Het
Top2b T A 14: 16,383,125 S38T probably benign Het
Trim33 A T 3: 103,329,256 T561S possibly damaging Het
Ttc39a C T 4: 109,416,021 Q25* probably null Het
Urb1 A G 16: 90,759,842 I1816T possibly damaging Het
Usp24 T C 4: 106,413,676 probably null Het
Usp36 A C 11: 118,263,070 L840R probably damaging Het
Usp50 C A 2: 126,777,853 probably benign Het
Vangl2 A G 1: 172,009,663 V193A possibly damaging Het
Vmn1r62 T A 7: 5,675,867 H182Q probably benign Het
Vmn2r124 A T 17: 18,073,745 Y698F probably benign Het
Wls C T 3: 159,897,445 T165I probably benign Het
Zfp808 G T 13: 62,171,292 E112* probably null Het
Other mutations in Fn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fn1 APN 1 71652873 missense probably benign 0.28
IGL00402:Fn1 APN 1 71641163 missense probably damaging 1.00
IGL00946:Fn1 APN 1 71645540 splice site probably benign
IGL01311:Fn1 APN 1 71628140 missense probably damaging 1.00
IGL01338:Fn1 APN 1 71626210 missense probably damaging 0.98
IGL01353:Fn1 APN 1 71586939 missense probably damaging 1.00
IGL01674:Fn1 APN 1 71606741 missense probably damaging 1.00
IGL01701:Fn1 APN 1 71629853 splice site probably benign
IGL01734:Fn1 APN 1 71619485 missense probably damaging 1.00
IGL01788:Fn1 APN 1 71613837 missense probably damaging 1.00
IGL02186:Fn1 APN 1 71638534 missense probably damaging 1.00
IGL02398:Fn1 APN 1 71618670 splice site probably null
IGL02425:Fn1 APN 1 71641143 splice site probably benign
IGL02516:Fn1 APN 1 71637323 missense possibly damaging 0.78
IGL02593:Fn1 APN 1 71602432 missense probably benign
IGL02651:Fn1 APN 1 71597676 missense possibly damaging 0.65
IGL02681:Fn1 APN 1 71619482 missense probably damaging 1.00
IGL02890:Fn1 APN 1 71598372 critical splice donor site probably null
IGL02929:Fn1 APN 1 71595662 critical splice donor site probably null
IGL03036:Fn1 APN 1 71629773 missense probably damaging 1.00
IGL03088:Fn1 APN 1 71614038 splice site probably null
IGL03142:Fn1 APN 1 71637296 missense probably damaging 1.00
IGL03172:Fn1 APN 1 71641262 missense probably damaging 0.99
IGL03184:Fn1 APN 1 71609497 missense probably benign 0.02
IGL03212:Fn1 APN 1 71641325 nonsense probably null
IGL03246:Fn1 APN 1 71624296 missense possibly damaging 0.89
IGL03367:Fn1 APN 1 71597553 missense probably benign 0.27
PIT4514001:Fn1 UTSW 1 71628456 missense probably benign 0.01
R0008:Fn1 UTSW 1 71595720 missense probably damaging 0.98
R0112:Fn1 UTSW 1 71609653 missense probably damaging 1.00
R0138:Fn1 UTSW 1 71624110 missense possibly damaging 0.82
R0383:Fn1 UTSW 1 71597685 missense probably damaging 0.99
R0386:Fn1 UTSW 1 71595786 missense probably damaging 1.00
R0648:Fn1 UTSW 1 71597585 missense possibly damaging 0.79
R0684:Fn1 UTSW 1 71595809 splice site probably null
R1054:Fn1 UTSW 1 71586214 makesense probably null
R1183:Fn1 UTSW 1 71586245 missense probably damaging 0.98
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1414:Fn1 UTSW 1 71601303 splice site probably benign
R1677:Fn1 UTSW 1 71597655 missense probably benign 0.00
R1773:Fn1 UTSW 1 71637383 missense probably damaging 1.00
R1830:Fn1 UTSW 1 71624259 missense probably damaging 1.00
R1987:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R1989:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R2068:Fn1 UTSW 1 71600439 missense probably damaging 1.00
R2113:Fn1 UTSW 1 71626164 missense probably damaging 1.00
R2145:Fn1 UTSW 1 71606004 missense probably damaging 1.00
R2246:Fn1 UTSW 1 71628535 missense probably benign 0.10
R2273:Fn1 UTSW 1 71613943 missense probably null 1.00
R2274:Fn1 UTSW 1 71613943 missense probably null 1.00
R2275:Fn1 UTSW 1 71613943 missense probably null 1.00
R2303:Fn1 UTSW 1 71614036 critical splice acceptor site probably null
R2379:Fn1 UTSW 1 71649284 nonsense probably null
R2382:Fn1 UTSW 1 71648119 missense probably damaging 1.00
R2567:Fn1 UTSW 1 71597736 nonsense probably null
R2864:Fn1 UTSW 1 71602419 missense probably damaging 0.99
R3154:Fn1 UTSW 1 71593083 missense probably damaging 1.00
R3837:Fn1 UTSW 1 71653155 utr 5 prime probably null
R3844:Fn1 UTSW 1 71609574 missense possibly damaging 0.61
R3886:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3887:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3888:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3889:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3905:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3906:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3907:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3909:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R4611:Fn1 UTSW 1 71624178 nonsense probably null
R4724:Fn1 UTSW 1 71648148 critical splice acceptor site probably null
R4732:Fn1 UTSW 1 71602512 splice site probably null
R4733:Fn1 UTSW 1 71602512 splice site probably null
R4756:Fn1 UTSW 1 71590808 missense probably damaging 1.00
R4839:Fn1 UTSW 1 71642083 missense probably damaging 1.00
R4915:Fn1 UTSW 1 71595809 splice site probably null
R4917:Fn1 UTSW 1 71595809 splice site probably null
R4918:Fn1 UTSW 1 71595809 splice site probably null
R5002:Fn1 UTSW 1 71629728 missense possibly damaging 0.48
R5015:Fn1 UTSW 1 71626177 missense probably damaging 0.98
R5022:Fn1 UTSW 1 71624179 missense probably damaging 1.00
R5109:Fn1 UTSW 1 71649235 missense probably damaging 1.00
R5267:Fn1 UTSW 1 71629704 missense probably damaging 1.00
R5323:Fn1 UTSW 1 71597432 missense probably benign 0.09
R5333:Fn1 UTSW 1 71624180 missense probably damaging 1.00
R5631:Fn1 UTSW 1 71590196 missense probably damaging 1.00
R5644:Fn1 UTSW 1 71627250 missense probably damaging 1.00
R5754:Fn1 UTSW 1 71600322 missense probably damaging 1.00
R5807:Fn1 UTSW 1 71648059 missense probably damaging 1.00
R6053:Fn1 UTSW 1 71599290 missense probably damaging 1.00
R6133:Fn1 UTSW 1 71597727 missense probably damaging 1.00
R6186:Fn1 UTSW 1 71637290 missense probably damaging 1.00
R6270:Fn1 UTSW 1 71637275 missense probably damaging 1.00
R6332:Fn1 UTSW 1 71628071 missense probably benign 0.01
R6431:Fn1 UTSW 1 71647844 intron probably null
R6571:Fn1 UTSW 1 71626190 missense probably damaging 1.00
R6596:Fn1 UTSW 1 71609482 missense probably damaging 1.00
R6862:Fn1 UTSW 1 71613907 missense probably benign 0.43
R6898:Fn1 UTSW 1 71600413 missense probably damaging 1.00
R6984:Fn1 UTSW 1 71626079 missense probably damaging 1.00
R7107:Fn1 UTSW 1 71627249 missense probably damaging 1.00
R7121:Fn1 UTSW 1 71600538 intron probably benign
R7127:Fn1 UTSW 1 71597544 missense probably benign 0.16
R7194:Fn1 UTSW 1 71602323 missense probably damaging 1.00
R7274:Fn1 UTSW 1 71628113 missense probably benign
R7285:Fn1 UTSW 1 71637339 missense probably damaging 1.00
R7426:Fn1 UTSW 1 71649225 missense probably damaging 1.00
R7453:Fn1 UTSW 1 71590880 missense probably damaging 1.00
R7508:Fn1 UTSW 1 71597516 missense probably benign 0.01
R7724:Fn1 UTSW 1 71603735 missense probably benign 0.02
R7848:Fn1 UTSW 1 71650601 missense probably damaging 1.00
R7931:Fn1 UTSW 1 71650601 missense probably damaging 1.00
X0023:Fn1 UTSW 1 71598373 critical splice donor site probably null
Z1088:Fn1 UTSW 1 71649292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGAATTTGTTAGCGCACTTGAG -3'
(R):5'- ACTCAAGATGCTCAGGGGTC -3'

Sequencing Primer
(F):5'- GGAAGAACAGACGGTCCCTAC -3'
(R):5'- GCTCAGGGGTCCGGGAC -3'
Posted On2016-08-25