Incidental Mutation 'R4809:Micu1'
ID 426227
Institutional Source Beutler Lab
Gene Symbol Micu1
Ensembl Gene ENSMUSG00000020111
Gene Name mitochondrial calcium uptake 1
Synonyms C730016L05Rik, Cbara1
MMRRC Submission 042428-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.775) question?
Stock # R4809 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 59538385-59699956 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 59576644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 167 (H167Y)
Ref Sequence ENSEMBL: ENSMUSP00000136567 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020311] [ENSMUST00000092508] [ENSMUST00000165563] [ENSMUST00000167612] [ENSMUST00000171409] [ENSMUST00000179709]
AlphaFold Q8VCX5
Predicted Effect probably benign
Transcript: ENSMUST00000020311
AA Change: H167Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020311
Gene: ENSMUSG00000020111
AA Change: H167Y

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 230 258 8.16e-1 SMART
EFh 420 448 4.12e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092508
AA Change: H167Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090166
Gene: ENSMUSG00000020111
AA Change: H167Y

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 228 256 8.16e-1 SMART
EFh 418 446 4.12e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165405
Predicted Effect probably benign
Transcript: ENSMUST00000165563
AA Change: H167Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126597
Gene: ENSMUSG00000020111
AA Change: H167Y

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Predicted Effect unknown
Transcript: ENSMUST00000167612
AA Change: H17Y
SMART Domains Protein: ENSMUSP00000126822
Gene: ENSMUSG00000020111
AA Change: H17Y

DomainStartEndE-ValueType
PDB:4NSD|B 1 35 2e-16 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167872
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170952
Predicted Effect probably benign
Transcript: ENSMUST00000171409
AA Change: H134Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000131000
Gene: ENSMUSG00000020111
AA Change: H134Y

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
low complexity region 56 61 N/A INTRINSIC
Pfam:EF-hand_6 191 221 1.8e-6 PFAM
Pfam:EF-hand_5 192 216 5.9e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179709
AA Change: H167Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000136567
Gene: ENSMUSG00000020111
AA Change: H167Y

DomainStartEndE-ValueType
low complexity region 89 94 N/A INTRINSIC
EFh 224 252 8.16e-1 SMART
EFh 414 442 4.12e-3 SMART
Meta Mutation Damage Score 0.0967 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.0%
Validation Efficiency 96% (96/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an essential regulator of mitochondrial Ca2+ uptake under basal conditions. The encoded protein interacts with the mitochondrial calcium uniporter, a mitochondrial inner membrane Ca2+ channel, and is essential in preventing mitochondrial Ca2+ overload, which can cause excessive production of reactive oxygen species and cell stress. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Mar 2013]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3425401B19Rik A G 14: 32,384,588 (GRCm39) V459A probably benign Het
Abca12 C T 1: 71,318,015 (GRCm39) A1840T probably benign Het
Abhd6 T G 14: 8,039,771 (GRCm38) M1R probably null Het
Abl1 T C 2: 31,690,254 (GRCm39) L572P probably damaging Het
Adamts2 C A 11: 50,694,517 (GRCm39) S1101R probably benign Het
Adgra2 G A 8: 27,600,507 (GRCm39) W200* probably null Het
AI661453 C A 17: 47,778,112 (GRCm39) probably benign Het
Aldh1l2 A G 10: 83,342,496 (GRCm39) F438S probably damaging Het
Ankrd49 G A 9: 14,692,510 (GRCm39) T218I possibly damaging Het
Ano7 T C 1: 93,322,288 (GRCm39) F410L probably benign Het
Aox4 T A 1: 58,305,808 (GRCm39) F1271I probably damaging Het
Aqr T C 2: 114,005,695 (GRCm39) probably benign Het
Arhgap42 A G 9: 9,180,118 (GRCm39) S54P probably damaging Het
Aunip C A 4: 134,238,450 (GRCm39) D16E possibly damaging Het
Btbd7 A G 12: 102,760,003 (GRCm39) probably null Het
Cabp4 T C 19: 4,189,290 (GRCm39) H89R probably benign Het
Ccni AAA AAACTAA 5: 93,335,429 (GRCm39) probably benign Het
Chfr C T 5: 110,306,700 (GRCm39) H410Y probably damaging Het
Churc1 C A 12: 76,829,671 (GRCm39) L111M probably damaging Het
Clasp1 C T 1: 118,388,980 (GRCm39) T113I probably benign Het
Col12a1 T A 9: 79,600,849 (GRCm39) Q745L probably benign Het
Col20a1 T C 2: 180,640,454 (GRCm39) L537P probably damaging Het
Creb5 A T 6: 53,587,411 (GRCm39) E47V probably null Het
Csnk1d A T 11: 120,854,668 (GRCm39) probably benign Het
Cts6 A T 13: 61,349,995 (GRCm39) W29R probably damaging Het
Dbt T A 3: 116,339,992 (GRCm39) I420N probably damaging Het
Det1 C A 7: 78,493,555 (GRCm39) D150Y probably damaging Het
Dlk2 A G 17: 46,609,940 (GRCm39) probably null Het
Dnmt3a A T 12: 3,950,352 (GRCm39) I639F probably damaging Het
Dock9 A T 14: 121,784,008 (GRCm39) Y1989N probably benign Het
Dsg4 A T 18: 20,599,678 (GRCm39) T765S possibly damaging Het
Entrep2 G A 7: 64,426,488 (GRCm39) T159I probably damaging Het
Epha5 C T 5: 84,253,750 (GRCm39) D548N possibly damaging Het
Fam227b T A 2: 125,958,045 (GRCm39) Y240F possibly damaging Het
Fbxw21 C T 9: 108,972,458 (GRCm39) V395I probably damaging Het
Fn1 C A 1: 71,691,959 (GRCm39) probably benign Het
Fpr-rs3 A T 17: 20,844,683 (GRCm39) S153T probably benign Het
Frem2 A G 3: 53,561,316 (GRCm39) F1064L probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gjd2 C T 2: 113,842,022 (GRCm39) G152R probably damaging Het
Gpr75 T C 11: 30,842,154 (GRCm39) I353T possibly damaging Het
Grb7 T C 11: 98,342,262 (GRCm39) V145A possibly damaging Het
Igkv4-73 G A 6: 69,174,807 (GRCm39) R40W unknown Het
Kif1c C T 11: 70,617,183 (GRCm39) A839V probably benign Het
Krt31 G A 11: 99,940,748 (GRCm39) A125V possibly damaging Het
Lamb1 A G 12: 31,328,525 (GRCm39) Y163C probably damaging Het
Mars1 G T 10: 127,136,084 (GRCm39) T535K probably damaging Het
Mdc1 T C 17: 36,159,993 (GRCm39) probably null Het
Micos10 C G 4: 138,858,268 (GRCm39) W10S probably damaging Het
Mrgprb1 C T 7: 48,097,739 (GRCm39) V58I possibly damaging Het
Ncoa7 T A 10: 30,647,758 (GRCm39) E6V possibly damaging Het
Nectin3 A C 16: 46,268,523 (GRCm39) probably benign Het
Or13a18 A G 7: 140,190,987 (GRCm39) K295E probably damaging Het
Or4k44 C T 2: 111,367,956 (GRCm39) C226Y probably benign Het
Or52ab7 T A 7: 102,977,730 (GRCm39) Y12* probably null Het
Or8k38 T A 2: 86,488,029 (GRCm39) M258L possibly damaging Het
Pex16 T C 2: 92,206,983 (GRCm39) S54P probably damaging Het
Pik3cg A T 12: 32,254,080 (GRCm39) S636T possibly damaging Het
Plin5 A G 17: 56,423,855 (GRCm39) S27P probably benign Het
Ptch1 A T 13: 63,661,522 (GRCm39) D1068E probably damaging Het
Ptprq T C 10: 107,399,036 (GRCm39) T1960A probably damaging Het
Rap1gap2 T C 11: 74,298,800 (GRCm39) probably benign Het
Rcc2 G A 4: 140,444,353 (GRCm39) R348Q probably damaging Het
Rhbdd3 C A 11: 5,055,949 (GRCm39) A377D probably damaging Het
Rpl7 T G 1: 16,172,189 (GRCm39) probably benign Het
Scn11a G T 9: 119,648,936 (GRCm39) D42E probably benign Het
Scube3 C T 17: 28,384,147 (GRCm39) R549W probably damaging Het
Sil1 A T 18: 35,458,428 (GRCm39) M189K probably damaging Het
Slc39a6 G A 18: 24,718,531 (GRCm39) Q225* probably null Het
Slc7a15 A T 12: 8,589,002 (GRCm39) C182S probably benign Het
Spata21 G A 4: 140,824,431 (GRCm39) probably null Het
Stim2 T C 5: 54,267,955 (GRCm39) V417A probably damaging Het
Szt2 T C 4: 118,246,182 (GRCm39) D993G probably damaging Het
Tet3 A G 6: 83,379,928 (GRCm39) S747P probably benign Het
Tmem86a C G 7: 46,702,678 (GRCm39) S34R possibly damaging Het
Top2b T A 14: 16,383,125 (GRCm38) S38T probably benign Het
Trim33 A T 3: 103,236,572 (GRCm39) T561S possibly damaging Het
Ttc39a C T 4: 109,273,218 (GRCm39) Q25* probably null Het
Urb1 A G 16: 90,556,730 (GRCm39) I1816T possibly damaging Het
Usp24 T C 4: 106,270,873 (GRCm39) probably null Het
Usp36 A C 11: 118,153,896 (GRCm39) L840R probably damaging Het
Usp50 C A 2: 126,619,773 (GRCm39) probably benign Het
Vangl2 A G 1: 171,837,230 (GRCm39) V193A possibly damaging Het
Vmn1r62 T A 7: 5,678,866 (GRCm39) H182Q probably benign Het
Vmn2r124 A T 17: 18,294,007 (GRCm39) Y698F probably benign Het
Wls C T 3: 159,603,082 (GRCm39) T165I probably benign Het
Zfp808 G T 13: 62,319,106 (GRCm39) E112* probably null Het
Other mutations in Micu1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01982:Micu1 APN 10 59,699,100 (GRCm39) missense possibly damaging 0.55
IGL02643:Micu1 APN 10 59,675,558 (GRCm39) missense probably damaging 1.00
IGL03183:Micu1 APN 10 59,563,870 (GRCm39) nonsense probably null
R0025:Micu1 UTSW 10 59,624,699 (GRCm39) critical splice acceptor site probably null
R0645:Micu1 UTSW 10 59,675,503 (GRCm39) missense possibly damaging 0.95
R0988:Micu1 UTSW 10 59,592,549 (GRCm39) intron probably benign
R1121:Micu1 UTSW 10 59,624,804 (GRCm39) missense possibly damaging 0.50
R1334:Micu1 UTSW 10 59,624,798 (GRCm39) missense probably damaging 1.00
R1762:Micu1 UTSW 10 59,699,082 (GRCm39) missense possibly damaging 0.70
R1925:Micu1 UTSW 10 59,568,983 (GRCm39) splice site probably benign
R1976:Micu1 UTSW 10 59,604,035 (GRCm39) missense probably damaging 1.00
R2082:Micu1 UTSW 10 59,699,129 (GRCm39) missense probably benign 0.00
R2152:Micu1 UTSW 10 59,699,110 (GRCm39) missense probably benign 0.01
R2395:Micu1 UTSW 10 59,699,024 (GRCm39) nonsense probably null
R3619:Micu1 UTSW 10 59,604,080 (GRCm39) splice site probably null
R3953:Micu1 UTSW 10 59,586,326 (GRCm39) missense probably benign 0.01
R4948:Micu1 UTSW 10 59,699,076 (GRCm39) missense possibly damaging 0.56
R5103:Micu1 UTSW 10 59,624,806 (GRCm39) missense possibly damaging 0.79
R5137:Micu1 UTSW 10 59,663,054 (GRCm39) missense probably benign 0.20
R5431:Micu1 UTSW 10 59,586,343 (GRCm39) missense possibly damaging 0.92
R5805:Micu1 UTSW 10 59,663,128 (GRCm39) missense possibly damaging 0.46
R6910:Micu1 UTSW 10 59,576,489 (GRCm39) missense probably damaging 1.00
R7030:Micu1 UTSW 10 59,624,843 (GRCm39) missense possibly damaging 0.92
R7845:Micu1 UTSW 10 59,675,607 (GRCm39) critical splice donor site probably null
R9124:Micu1 UTSW 10 59,586,335 (GRCm39) missense probably damaging 1.00
R9255:Micu1 UTSW 10 59,604,051 (GRCm39) missense probably damaging 1.00
R9736:Micu1 UTSW 10 59,699,123 (GRCm39) nonsense probably null
Z1177:Micu1 UTSW 10 59,563,863 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAGAGAACGGCGAGCCTTG -3'
(R):5'- TTGGCTAGTTCCCCTAAATGAG -3'

Sequencing Primer
(F):5'- TCCAACTTTCTCGTTTCAGGTGATG -3'
(R):5'- GACATATACACTGGATTGTAGAAGC -3'
Posted On 2016-08-25