Incidental Mutation 'R4888:Polg'
ID426232
Institutional Source Beutler Lab
Gene Symbol Polg
Ensembl Gene ENSMUSG00000039176
Gene Namepolymerase (DNA directed), gamma
SynonymsPol gamma, Polga, mitochondrial DNA polymerase gamma, mitochondrial DNA polymerase-gamma, polymerase gamma
MMRRC Submission 042493-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4888 (G1)
Quality Score211
Status Validated
Chromosome7
Chromosomal Location79446231-79466362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 79464605 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 203 (W203R)
Ref Sequence ENSEMBL: ENSMUSP00000119616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073889] [ENSMUST00000125562] [ENSMUST00000132048] [ENSMUST00000149444]
Predicted Effect probably damaging
Transcript: ENSMUST00000073889
AA Change: W203R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073551
Gene: ENSMUSG00000039176
AA Change: W203R

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
low complexity region 131 149 N/A INTRINSIC
low complexity region 478 493 N/A INTRINSIC
POLAc 849 1123 2.23e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125562
SMART Domains Protein: ENSMUSP00000143813
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 106 8e-25 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127082
Predicted Effect probably damaging
Transcript: ENSMUST00000132048
AA Change: W203R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143933
Gene: ENSMUSG00000039176
AA Change: W203R

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 203 2e-71 PDB
SCOP:d1qm9a1 76 122 3e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142915
Predicted Effect probably benign
Transcript: ENSMUST00000143672
SMART Domains Protein: ENSMUSP00000122286
Gene: ENSMUSG00000039176

DomainStartEndE-ValueType
PDB:3IKM|D 2 243 1e-117 PDB
SCOP:d1t7pa2 141 243 1e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000149444
AA Change: W203R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119616
Gene: ENSMUSG00000039176
AA Change: W203R

DomainStartEndE-ValueType
low complexity region 26 37 N/A INTRINSIC
PDB:3IKM|D 53 490 N/A PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201557
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205285
Meta Mutation Damage Score 0.9729 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 94.1%
Validation Efficiency 99% (150/151)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mitochondrial DNA polymerase is heterotrimeric, consisting of a homodimer of accessory subunits plus a catalytic subunit. The protein encoded by this gene is the catalytic subunit of mitochondrial DNA polymerase. The encoded protein contains a polyglutamine tract near its N-terminus that may be polymorphic. Defects in this gene are a cause of progressive external ophthalmoplegia with mitochondrial DNA deletions 1 (PEOA1), sensory ataxic neuropathy dysarthria and ophthalmoparesis (SANDO), Alpers-Huttenlocher syndrome (AHS), and mitochondrial neurogastrointestinal encephalopathy syndrome (MNGIE). Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous proof-reading deficient mutants display reduced life spans and premature aging with weight loss, decreased subcutaneous fat, alopecia, kyphosis, osteoporosis, anemia, reduced fertility, and enlarged hearts. Homozygous null mice display embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 139 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931403M11Rik C A 14: 24,621,351 noncoding transcript Het
4931408C20Rik A G 1: 26,683,547 Y851H probably benign Het
Abca7 A G 10: 80,002,728 K612R probably damaging Het
Adamtsl3 T C 7: 82,574,614 V275A possibly damaging Het
Afg3l1 G A 8: 123,488,326 probably null Het
Alcam T A 16: 52,268,813 H508L probably benign Het
Ankrd45 G A 1: 161,155,372 R151H probably damaging Het
Aqr G A 2: 114,150,509 L264F probably damaging Het
Arfgef2 G A 2: 166,835,613 A53T probably damaging Het
Arhgap30 A G 1: 171,409,312 T1085A probably benign Het
Atp10a T C 7: 58,785,307 V314A probably damaging Het
Bdp1 T C 13: 100,051,119 D1580G probably benign Het
Btbd17 T A 11: 114,794,091 T41S possibly damaging Het
Cacna1c T C 6: 118,751,439 N378S probably damaging Het
Camsap1 G T 2: 25,935,550 Q1375K probably benign Het
Catsper2 G T 2: 121,397,123 probably null Het
Ccar1 A G 10: 62,753,218 S829P unknown Het
Ccdc180 T C 4: 45,909,308 L492P probably damaging Het
Ccser2 A T 14: 36,940,386 N280K probably damaging Het
Cd37 T C 7: 45,233,935 D271G probably damaging Het
Cdcp1 G A 9: 123,182,129 probably benign Het
Cep85 T A 4: 134,164,751 probably benign Het
Cfi C T 3: 129,873,077 P483L probably damaging Het
Csmd1 A G 8: 15,895,674 probably benign Het
Cytl1 G T 5: 37,735,574 L9F unknown Het
Defb26 T C 2: 152,508,165 E65G possibly damaging Het
Degs1 G A 1: 182,276,805 T305I probably damaging Het
Dnttip2 T G 3: 122,276,592 C485W probably damaging Het
Ecel1 G A 1: 87,148,727 probably benign Het
Edrf1 G T 7: 133,658,610 M83I probably damaging Het
Elmo2 A T 2: 165,295,289 C562S probably benign Het
Etl4 T A 2: 20,340,111 probably null Het
F2r A C 13: 95,604,397 V210G probably damaging Het
Fam171a1 T A 2: 3,223,509 V179E probably damaging Het
Fmod G T 1: 134,040,239 V6F possibly damaging Het
Foxr2 A G X: 153,130,316 Q61R probably damaging Het
Gabra4 G A 5: 71,572,203 H76Y probably benign Het
Gck A T 11: 5,909,150 M139K possibly damaging Het
Gif A G 19: 11,752,219 T181A probably benign Het
Gm10192 C G 4: 97,183,108 S20T probably null Het
Gm13088 A G 4: 143,654,401 S351P probably benign Het
Gm44501 T C 17: 40,576,624 L11P unknown Het
Gm572 T C 4: 148,666,845 probably null Het
Gm996 G A 2: 25,579,747 R51C possibly damaging Het
Gnas A G 2: 174,298,089 K17R possibly damaging Het
Grm2 T A 9: 106,650,666 S340C probably damaging Het
Gsc T A 12: 104,472,015 H198L probably damaging Het
H2-Q3 A T 17: 35,359,448 noncoding transcript Het
Hist1h4a T C 13: 23,760,952 D69G probably damaging Het
Hivep3 A G 4: 120,122,934 E1723G probably damaging Het
Hk3 A T 13: 55,006,592 L757Q probably damaging Het
Homer2 A T 7: 81,649,563 D51E probably benign Het
Ier3ip1 T A 18: 76,939,531 probably benign Het
Itch T A 2: 155,217,977 probably null Het
Kalrn T A 16: 34,171,330 Q974L probably damaging Het
Kirrel3 G T 9: 35,013,305 G296W probably damaging Het
Klhl17 A G 4: 156,230,625 V525A probably benign Het
Klhl9 T C 4: 88,721,945 K20E probably benign Het
Kmt2a G T 9: 44,821,680 probably benign Het
Krt17 C A 11: 100,256,479 V409L probably benign Het
Lmx1b T C 2: 33,564,790 N322S probably benign Het
Lrrc63 G C 14: 75,125,966 P242A probably benign Het
Ltk T C 2: 119,753,227 N256D probably damaging Het
Map3k19 T A 1: 127,817,733 E1328V probably damaging Het
Map4k2 C T 19: 6,344,003 A280V probably benign Het
Mettl11b A T 1: 163,703,064 C269S probably benign Het
Micall1 C T 15: 79,131,848 R802* probably null Het
Mmp14 A G 14: 54,436,205 R109G probably damaging Het
Mmp27 A T 9: 7,581,368 H544L probably benign Het
Mpeg1 A G 19: 12,463,070 T631A probably damaging Het
Mpnd A G 17: 56,011,641 M217V probably benign Het
Mrc2 T C 11: 105,341,208 V862A probably damaging Het
Mug2 T A 6: 122,081,195 S1239T probably damaging Het
Myb T A 10: 21,126,238 M616L probably benign Het
Myo18b A T 5: 112,874,480 probably benign Het
Myo1c C A 11: 75,669,227 T703N probably damaging Het
Myt1l T G 12: 29,886,139 C909G unknown Het
Nbea T C 3: 56,005,355 S1004G possibly damaging Het
Neb T C 2: 52,296,307 N918D probably benign Het
Nrtn T C 17: 56,751,636 T122A probably damaging Het
Nsd3 A T 8: 25,698,911 S1042C probably damaging Het
Nvl A G 1: 181,117,626 L461S probably damaging Het
Olfr1339 A C 4: 118,734,688 H53P probably benign Het
Olfr1346 A T 7: 6,474,613 I168F probably damaging Het
Olfr1425 C G 19: 12,074,315 G106R probably damaging Het
Olfr368 T G 2: 37,332,589 F281V probably damaging Het
Olfr677 A G 7: 105,056,482 T79A possibly damaging Het
Olfr786 A C 10: 129,437,379 D189A possibly damaging Het
Olfr90 G A 17: 37,085,451 T238I probably damaging Het
Onecut2 A T 18: 64,340,927 H183L possibly damaging Het
Pcdhb21 G T 18: 37,515,077 V420F possibly damaging Het
Pcdhb9 G A 18: 37,403,233 G760D probably benign Het
Pglyrp2 G A 17: 32,418,797 P86S probably benign Het
Phyhip T A 14: 70,467,325 V328E probably damaging Het
Pitpnb A T 5: 111,382,996 K218N possibly damaging Het
Pitrm1 A G 13: 6,578,560 D963G probably damaging Het
Pmfbp1 A G 8: 109,532,160 Y699C probably damaging Het
Pmpcb T A 5: 21,740,662 probably benign Het
Prss41 A T 17: 23,837,003 M252K probably benign Het
Prss46 A T 9: 110,844,550 M1L possibly damaging Het
Rimklb T C 6: 122,464,092 probably null Het
Rngtt T C 4: 33,500,335 I556T unknown Het
Rock1 A C 18: 10,122,698 D374E probably benign Het
Rspry1 C A 8: 94,658,789 H450N probably benign Het
Rusc2 T C 4: 43,423,942 V1032A probably damaging Het
Sacs A G 14: 61,212,198 R3898G probably damaging Het
Scnn1b A T 7: 121,902,887 H256L probably benign Het
Sh3gl2 T A 4: 85,379,257 H157Q probably benign Het
Sipa1l1 C A 12: 82,342,333 S444R probably damaging Het
Sntg1 T A 1: 8,363,594 I478F probably damaging Het
Sptb G T 12: 76,609,037 L1424M probably benign Het
Sry T A Y: 2,663,105 H185L unknown Het
Stox2 T G 8: 47,203,163 T93P probably damaging Het
Tatdn2 T A 6: 113,704,605 F472Y possibly damaging Het
Tefm A T 11: 80,140,359 V17D possibly damaging Het
Tekt2 G T 4: 126,324,667 T70N probably benign Het
Ticam1 T C 17: 56,271,642 D151G probably damaging Het
Tmem2 T C 19: 21,856,164 V1322A probably benign Het
Tmem63c A G 12: 87,089,365 E785G probably damaging Het
Tnmd A T X: 133,864,802 N219I probably benign Het
Ttc14 T A 3: 33,806,875 L407* probably null Het
Ttll7 T C 3: 146,894,177 M1T probably null Het
Ttn T A 2: 76,916,491 probably null Het
Uchl1 T C 5: 66,676,437 M12T probably benign Het
Uggt2 T C 14: 119,049,253 T224A probably damaging Het
Uggt2 A T 14: 119,077,650 probably null Het
Umodl1 A G 17: 30,999,201 E1254G probably damaging Het
Unc5d A G 8: 28,666,899 F773L probably benign Het
Unc80 C A 1: 66,644,447 P2216Q probably damaging Het
Usp40 T A 1: 87,986,201 probably null Het
Vmn1r117 A T 7: 20,883,496 M209K probably damaging Het
Vmn2r44 A T 7: 8,377,986 W303R probably benign Het
Wnk2 G A 13: 49,071,002 R268C probably damaging Het
Wnt2 T C 6: 18,023,126 K175E possibly damaging Het
Xkr6 T C 14: 63,819,504 V288A unknown Het
Zfp125 A G 12: 20,900,458 noncoding transcript Het
Zfp512b A C 2: 181,587,063 V703G probably damaging Het
Zglp1 A T 9: 21,062,661 I243N probably benign Het
Zgpat T C 2: 181,378,858 S275P probably benign Het
Other mutations in Polg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:Polg APN 7 79451925 missense probably damaging 1.00
IGL00970:Polg APN 7 79451745 missense probably benign 0.01
IGL01883:Polg APN 7 79458318 missense probably damaging 1.00
IGL02124:Polg APN 7 79459737 missense probably damaging 1.00
IGL02127:Polg APN 7 79458167 unclassified probably benign
IGL02820:Polg APN 7 79459771 missense possibly damaging 0.92
IGL03075:Polg APN 7 79451912 missense probably damaging 1.00
IGL03180:Polg APN 7 79451853 splice site probably benign
IGL03198:Polg APN 7 79451722 missense probably damaging 1.00
IGL03222:Polg APN 7 79454656 missense probably damaging 0.98
R0030:Polg UTSW 7 79452128 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0064:Polg UTSW 7 79461884 missense probably damaging 1.00
R0416:Polg UTSW 7 79452240 unclassified probably benign
R0522:Polg UTSW 7 79460151 splice site probably benign
R0638:Polg UTSW 7 79460148 splice site probably benign
R1263:Polg UTSW 7 79459786 missense probably benign
R1831:Polg UTSW 7 79459770 missense probably benign 0.41
R1873:Polg UTSW 7 79456493 missense probably benign 0.04
R1906:Polg UTSW 7 79460322 missense probably damaging 1.00
R1997:Polg UTSW 7 79459231 missense probably damaging 1.00
R2127:Polg UTSW 7 79464928 missense probably damaging 1.00
R2155:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2156:Polg UTSW 7 79461720 missense possibly damaging 0.94
R2173:Polg UTSW 7 79455593 missense probably damaging 0.99
R3720:Polg UTSW 7 79456791 nonsense probably null
R4082:Polg UTSW 7 79464828 missense probably damaging 1.00
R4127:Polg UTSW 7 79455537 missense probably damaging 1.00
R4510:Polg UTSW 7 79455522 missense probably benign 0.01
R4511:Polg UTSW 7 79455522 missense probably benign 0.01
R4571:Polg UTSW 7 79460379 missense probably damaging 1.00
R5008:Polg UTSW 7 79460074 missense probably damaging 1.00
R5095:Polg UTSW 7 79460300 missense possibly damaging 0.92
R5121:Polg UTSW 7 79464605 missense probably damaging 1.00
R5139:Polg UTSW 7 79450025 missense probably damaging 1.00
R5213:Polg UTSW 7 79454098 missense probably damaging 1.00
R5285:Polg UTSW 7 79465225 utr 5 prime probably benign
R5498:Polg UTSW 7 79454670 missense probably damaging 1.00
R5714:Polg UTSW 7 79451991 missense possibly damaging 0.53
R5940:Polg UTSW 7 79454071 missense possibly damaging 0.95
R6146:Polg UTSW 7 79450512 missense probably benign 0.02
R6754:Polg UTSW 7 79459836 missense probably damaging 1.00
R6791:Polg UTSW 7 79460109 missense probably benign 0.25
R6829:Polg UTSW 7 79460109 missense probably benign 0.25
R6913:Polg UTSW 7 79460657 missense probably damaging 0.97
R7644:Polg UTSW 7 79451668 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGGTCATCTTAAATGGTCTCTCAG -3'
(R):5'- AGAGCCTGCCTTACTTGGAG -3'

Sequencing Primer
(F):5'- TCCGAATGGGCCCTGATATG -3'
(R):5'- GCCGCCTCGTTATTGGAG -3'
Posted On2016-08-30