Incidental Mutation 'R4797:Glb1l3'
ID426239
Institutional Source Beutler Lab
Gene Symbol Glb1l3
Ensembl Gene ENSMUSG00000031966
Gene Namegalactosidase, beta 1 like 3
Synonyms
MMRRC Submission 042421-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R4797 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location26817953-26860890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26828446 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 356 (D356G)
Ref Sequence ENSEMBL: ENSMUSP00000147979 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034448] [ENSMUST00000210274]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034448
AA Change: D280G

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034448
Gene: ENSMUSG00000031966
AA Change: D280G

DomainStartEndE-ValueType
Pfam:Glyco_hydro_35 1 304 1.5e-110 PFAM
Pfam:Glyco_hydro_42 7 160 6.2e-11 PFAM
low complexity region 309 318 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209592
Predicted Effect probably damaging
Transcript: ENSMUST00000210274
AA Change: D356G

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211353
Meta Mutation Damage Score 0.8877 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.8%
Validation Efficiency 96% (69/72)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca9 T C 11: 110,118,119 T1195A probably benign Het
Apobr G A 7: 126,587,584 E756K probably benign Het
Arpc3 A G 5: 122,404,152 E77G possibly damaging Het
Atp2b2 A T 6: 113,789,886 M464K possibly damaging Het
Atxn7l2 A G 3: 108,204,550 S379P probably damaging Het
Ccdc91 A T 6: 147,592,143 E344D unknown Het
Cdc42bpg G A 19: 6,320,447 R1190Q probably damaging Het
Cdh17 C A 4: 11,810,390 Q694K probably benign Het
Chordc1 G T 9: 18,292,376 probably benign Het
Copg1 A G 6: 87,903,468 probably benign Het
Dcbld1 T C 10: 52,284,127 V37A probably damaging Het
Ddb2 A G 2: 91,236,818 probably benign Het
Dok5 A T 2: 170,830,122 R115* probably null Het
Drc7 T C 8: 95,074,297 I649T probably damaging Het
E130309D02Rik A G 5: 143,311,749 F181S probably benign Het
Efr3a A G 15: 65,857,588 T713A probably damaging Het
Epg5 G A 18: 78,030,399 D2494N probably benign Het
Eps15 G A 4: 109,366,530 probably benign Het
Gm10639 A T 9: 78,304,397 Y147F probably benign Het
Gm1818 A T 12: 48,555,610 noncoding transcript Het
Gm4450 T A 3: 98,456,431 R62* probably null Het
Hcrtr2 C A 9: 76,254,534 M191I probably damaging Het
Heatr1 G A 13: 12,412,048 E685K probably benign Het
Hsd3b2 A T 3: 98,711,663 L322Q probably damaging Het
Htra4 T C 8: 25,033,659 T297A probably damaging Het
Il22 C A 10: 118,205,153 R55S probably damaging Het
Ints1 G A 5: 139,771,876 T324M possibly damaging Het
Ints7 T C 1: 191,596,933 V268A probably damaging Het
Kctd20 G A 17: 28,966,792 V370I probably damaging Het
Lama1 T A 17: 67,716,775 M55K probably benign Het
Larp1 C A 11: 58,047,980 S494* probably null Het
Ldb3 A T 14: 34,555,513 H262Q possibly damaging Het
Lepr C A 4: 101,780,047 T711K possibly damaging Het
Mon2 T C 10: 123,016,517 I984V probably benign Het
Naip2 T A 13: 100,161,735 S598C probably damaging Het
Oasl1 A G 5: 114,928,158 M112V probably benign Het
Olfr371 G T 8: 85,230,938 A148S probably benign Het
Olfr715b A T 7: 107,106,027 M278K probably benign Het
Olfr807 A T 10: 129,754,521 S310T probably benign Het
P2ry1 T A 3: 61,003,460 S7T probably benign Het
Pidd1 G T 7: 141,442,986 R98S possibly damaging Het
Pkd1l1 A C 11: 8,961,340 F312L unknown Het
Pla2r1 A T 2: 60,504,180 M416K possibly damaging Het
Pold1 T C 7: 44,541,901 E194G possibly damaging Het
Poldip2 T A 11: 78,513,987 Y77N probably damaging Het
Ppp2r3a G T 9: 101,211,980 N381K probably benign Het
Prrc2a G A 17: 35,150,042 P2006L probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsu1 A G 2: 13,216,726 probably benign Het
Selenoi T A 5: 30,252,742 W90R probably damaging Het
Spag17 T A 3: 99,984,479 D216E possibly damaging Het
Spata31 C A 13: 64,922,742 Y901* probably null Het
Ssrp1 T A 2: 85,045,722 Y607* probably null Het
Stk10 T A 11: 32,598,471 N346K probably benign Het
Surf1 G T 2: 26,916,346 probably benign Het
Synj2 A T 17: 6,033,888 E283V probably damaging Het
Tg G A 15: 66,758,006 probably null Het
Traf1 A T 2: 34,956,277 D42E probably benign Het
Ttn T C 2: 76,740,865 I26561M probably damaging Het
Ubp1 T C 9: 113,956,002 Y128H probably damaging Het
Vmn1r216 T A 13: 23,099,336 I63K probably benign Het
Vmn1r49 T A 6: 90,072,630 H130L probably benign Het
Vmn2r90 C T 17: 17,712,305 T158I probably damaging Het
Vps13d T C 4: 145,054,155 S885G probably damaging Het
Other mutations in Glb1l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Glb1l3 APN 9 26853671 missense probably damaging 1.00
IGL00537:Glb1l3 APN 9 26829050 missense probably damaging 1.00
IGL01139:Glb1l3 APN 9 26818227 missense probably benign 0.00
IGL01397:Glb1l3 APN 9 26825195 missense probably benign
IGL01603:Glb1l3 APN 9 26859536 missense probably damaging 1.00
IGL01938:Glb1l3 APN 9 26818529 missense probably damaging 0.98
IGL02051:Glb1l3 APN 9 26825168 missense probably benign 0.39
IGL02105:Glb1l3 APN 9 26818527 missense probably damaging 0.99
IGL02132:Glb1l3 APN 9 26825170 missense probably benign 0.07
IGL02249:Glb1l3 APN 9 26831268 missense possibly damaging 0.60
IGL02363:Glb1l3 APN 9 26853644 missense probably damaging 1.00
IGL02824:Glb1l3 APN 9 26850109 missense probably damaging 1.00
IGL02938:Glb1l3 APN 9 26826759 missense probably benign 0.26
IGL03181:Glb1l3 APN 9 26828363 splice site probably null
IGL03288:Glb1l3 APN 9 26818305 missense probably damaging 0.99
IGL03299:Glb1l3 APN 9 26859452 missense probably damaging 1.00
R0479:Glb1l3 UTSW 9 26829093 missense probably benign 0.31
R4036:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4037:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4038:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4039:Glb1l3 UTSW 9 26829047 missense probably damaging 1.00
R4840:Glb1l3 UTSW 9 26829053 missense probably benign 0.06
R5645:Glb1l3 UTSW 9 26824826 missense probably benign
R5907:Glb1l3 UTSW 9 26826383 missense probably damaging 1.00
R5916:Glb1l3 UTSW 9 26854736 missense probably benign 0.20
R6428:Glb1l3 UTSW 9 26859452 missense probably damaging 1.00
R6489:Glb1l3 UTSW 9 26826831 missense probably benign 0.31
R6532:Glb1l3 UTSW 9 26818442 missense probably benign 0.02
R6560:Glb1l3 UTSW 9 26828424 synonymous probably null
R6653:Glb1l3 UTSW 9 26859588 missense probably benign 0.09
R6802:Glb1l3 UTSW 9 26859352 intron probably null
R7347:Glb1l3 UTSW 9 26829003 missense probably benign
R7531:Glb1l3 UTSW 9 26853654 missense possibly damaging 0.62
R7542:Glb1l3 UTSW 9 26818195 missense possibly damaging 0.70
Predicted Primers PCR Primer
(F):5'- GCTTCACAAGATGCTATCCCC -3'
(R):5'- ACTAGGATCCGGGGTTGAAG -3'

Sequencing Primer
(F):5'- ATGCTATCCCCCATAAAAGACTTTTC -3'
(R):5'- CCAGATAGAATTTGGGGAAGGTTTC -3'
Posted On2016-08-30