Incidental Mutation 'R4491:Cdhr5'
ID426252
Institutional Source Beutler Lab
Gene Symbol Cdhr5
Ensembl Gene ENSMUSG00000025497
Gene Namecadherin-related family member 5
Synonyms1810074H01Rik, Mupcdh, Mucdhl
MMRRC Submission 041747-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R4491 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location141269083-141276786 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 141274057 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 173 (N173D)
Ref Sequence ENSEMBL: ENSMUSP00000127292 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046156] [ENSMUST00000080654] [ENSMUST00000167263] [ENSMUST00000167790] [ENSMUST00000210124] [ENSMUST00000210773] [ENSMUST00000211667]
Predicted Effect probably benign
Transcript: ENSMUST00000046156
SMART Domains Protein: ENSMUSP00000041519
Gene: ENSMUSG00000038580

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
GLUCA 32 58 1.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000080654
AA Change: N173D

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000079484
Gene: ENSMUSG00000025497
AA Change: N173D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 3e-24 BLAST
transmembrane domain 478 500 N/A INTRINSIC
low complexity region 546 580 N/A INTRINSIC
low complexity region 634 653 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000167263
AA Change: N173D

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000127292
Gene: ENSMUSG00000025497
AA Change: N173D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
CA 53 125 3.78e-2 SMART
CA 152 238 2.34e-1 SMART
Blast:CA 277 355 3e-35 BLAST
Blast:CA 388 458 1e-24 BLAST
low complexity region 462 476 N/A INTRINSIC
low complexity region 496 518 N/A INTRINSIC
low complexity region 520 544 N/A INTRINSIC
low complexity region 559 576 N/A INTRINSIC
transmembrane domain 640 662 N/A INTRINSIC
low complexity region 708 742 N/A INTRINSIC
low complexity region 796 815 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167790
SMART Domains Protein: ENSMUSP00000128729
Gene: ENSMUSG00000038580

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
GLUCA 32 58 1.16e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210386
Predicted Effect probably benign
Transcript: ENSMUST00000210773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210928
Predicted Effect probably benign
Transcript: ENSMUST00000211667
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 98% (64/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a novel mucin-like gene that is a member of the cadherin superfamily. While encoding nonpolymorphic tandem repeats rich in proline, serine and threonine similar to mucin proteins, the gene also contains sequence encoding calcium-binding motifs found in all cadherins. The role of the hybrid extracellular region and the specific function of this protein have not yet been determined. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610040J01Rik C A 5: 63,898,469 P183T probably damaging Het
6430573F11Rik G A 8: 36,505,606 C70Y probably damaging Het
Bcan G A 3: 87,990,233 R682* probably null Het
Bzw1 T A 1: 58,404,259 L410Q probably damaging Het
Cdh5 A T 8: 104,113,040 I48F probably damaging Het
Cfap74 T C 4: 155,429,171 M480T probably benign Het
Col6a5 C T 9: 105,940,012 A367T unknown Het
Colca2 A G 9: 51,270,655 F206L probably benign Het
Cpsf1 A C 15: 76,597,722 Y1064D possibly damaging Het
Defb6 A T 8: 19,228,074 H54L probably benign Het
Dmtf1 A G 5: 9,140,379 probably benign Het
Dnah12 T C 14: 26,734,603 L827S possibly damaging Het
Dsc3 T C 18: 20,001,865 T21A probably benign Het
Epb41l1 G T 2: 156,522,168 D866Y probably benign Het
Epha1 T C 6: 42,360,666 M860V probably damaging Het
Far2 T C 6: 148,173,409 L380P possibly damaging Het
Fgd5 A G 6: 91,989,299 I680V possibly damaging Het
Fnbp4 T C 2: 90,752,968 probably null Het
Focad G A 4: 88,359,905 probably null Het
Gm14180 T A 11: 99,730,313 probably benign Het
Hbb-bh2 T C 7: 103,840,415 T5A probably benign Het
Ighv7-2 A G 12: 113,912,480 F2L probably benign Het
Igsf5 A G 16: 96,364,081 T19A probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Klb A G 5: 65,375,794 N482S probably benign Het
Lipo2 A C 19: 33,721,700 L310R probably damaging Het
Mc3r A G 2: 172,249,203 H115R possibly damaging Het
Meioc A G 11: 102,674,920 D398G possibly damaging Het
Olfr1130 G A 2: 87,607,392 M1I probably null Het
Olfr1353 T C 10: 78,970,317 S223P probably damaging Het
Olfr683 A T 7: 105,143,776 C172* probably null Het
Pds5a T C 5: 65,635,437 T718A probably benign Het
Pdzd2 C T 15: 12,385,637 D1016N possibly damaging Het
Pla2g2c T C 4: 138,734,408 probably null Het
Plch1 T C 3: 63,740,739 I404V probably damaging Het
Ppp2r5c A T 12: 110,580,522 D522V possibly damaging Het
Prex2 T A 1: 11,162,263 S851R probably benign Het
Rapgef1 C T 2: 29,719,656 P702S possibly damaging Het
Rasal3 T A 17: 32,391,385 D976V probably damaging Het
Rasef A C 4: 73,734,503 L587R probably damaging Het
Rptn A T 3: 93,396,511 R384* probably null Het
Sema6a G A 18: 47,306,457 probably benign Het
Sycp2 G T 2: 178,374,985 T608K probably damaging Het
Syde1 C T 10: 78,590,228 R35H probably benign Het
Taf1 G T X: 101,543,059 M313I possibly damaging Het
Taf15 A T 11: 83,484,694 T31S probably benign Het
Tktl2 T C 8: 66,512,012 V74A probably damaging Het
Tle4 A G 19: 14,454,865 V489A probably damaging Het
Tmem30a T C 9: 79,777,285 H95R probably damaging Het
Vmn1r75 C A 7: 11,880,982 Q214K probably damaging Het
Vps13c C T 9: 67,910,193 T1049M probably benign Het
Wdr78 T C 4: 103,066,399 E411G probably benign Het
Zfp37 T C 4: 62,192,128 Q274R probably benign Het
Zfp648 T G 1: 154,205,127 L344R probably damaging Het
Other mutations in Cdhr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02097:Cdhr5 APN 7 141269981 missense probably damaging 0.99
IGL02662:Cdhr5 APN 7 141274503 missense possibly damaging 0.57
R0002:Cdhr5 UTSW 7 141270020 splice site probably null
R0098:Cdhr5 UTSW 7 141269868 missense probably damaging 1.00
R0201:Cdhr5 UTSW 7 141276378 missense probably damaging 1.00
R0494:Cdhr5 UTSW 7 141272518 missense probably damaging 1.00
R0508:Cdhr5 UTSW 7 141272899 missense probably benign 0.41
R0918:Cdhr5 UTSW 7 141272149 missense probably damaging 1.00
R1570:Cdhr5 UTSW 7 141271769 missense probably damaging 1.00
R1571:Cdhr5 UTSW 7 141272170 missense probably damaging 1.00
R1838:Cdhr5 UTSW 7 141272603 missense possibly damaging 0.93
R3912:Cdhr5 UTSW 7 141273857 missense probably damaging 1.00
R4289:Cdhr5 UTSW 7 141272839 missense probably damaging 0.99
R4838:Cdhr5 UTSW 7 141273731 missense probably damaging 1.00
R4949:Cdhr5 UTSW 7 141272644 missense probably damaging 0.97
R5187:Cdhr5 UTSW 7 141274448 missense probably damaging 1.00
R5344:Cdhr5 UTSW 7 141276524 missense probably damaging 0.97
R5642:Cdhr5 UTSW 7 141269197 nonsense probably null
R6736:Cdhr5 UTSW 7 141272531 missense probably damaging 0.97
R7172:Cdhr5 UTSW 7 141271928 missense possibly damaging 0.90
R7212:Cdhr5 UTSW 7 141272659 missense probably damaging 0.99
R7693:Cdhr5 UTSW 7 141271778 missense probably benign
RF016:Cdhr5 UTSW 7 141272184 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- GTGGCTGGGCTCTACATTTTCC -3'
(R):5'- TGAAGGCTACAGATGCTGAC -3'

Sequencing Primer
(F):5'- CTCCCAAGTATCCTGTAGTGAC -3'
(R):5'- GCTGACATAAATGACATCCTAGTC -3'
Posted On2016-08-31