Incidental Mutation 'R5406:Ncstn'
ID426261
Institutional Source Beutler Lab
Gene Symbol Ncstn
Ensembl Gene ENSMUSG00000003458
Gene Namenicastrin
SynonymsNct, nicastrin, D1Dau13e, 9430068N19Rik
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location172066013-172082795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 172072164 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 317 (V317A)
Ref Sequence ENSEMBL: ENSMUSP00000003550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000140643] [ENSMUST00000146137]
Predicted Effect probably benign
Transcript: ENSMUST00000003550
AA Change: V317A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458
AA Change: V317A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Peptidase_M28 254 468 2.9e-7 PFAM
Pfam:Nicastrin 273 498 1.6e-94 PFAM
transmembrane domain 669 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135928
Predicted Effect probably benign
Transcript: ENSMUST00000140643
SMART Domains Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146137
SMART Domains Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Ncstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Ncstn APN 1 172074401 missense probably benign 0.02
IGL02030:Ncstn APN 1 172072457 splice site probably benign
IGL02470:Ncstn APN 1 172082599 critical splice donor site probably null
IGL02498:Ncstn APN 1 172068592 missense probably benign
Pig UTSW 1 172071525 missense probably damaging 1.00
truffle UTSW 1 172070009 missense probably damaging 1.00
R0048:Ncstn UTSW 1 172069961 splice site probably benign
R0480:Ncstn UTSW 1 172082592 splice site probably benign
R0648:Ncstn UTSW 1 172067887 missense probably benign 0.01
R0792:Ncstn UTSW 1 172071505 missense possibly damaging 0.95
R1330:Ncstn UTSW 1 172071525 missense probably damaging 1.00
R1524:Ncstn UTSW 1 172072149 missense possibly damaging 0.58
R1660:Ncstn UTSW 1 172066772 missense possibly damaging 0.78
R1828:Ncstn UTSW 1 172071471 frame shift probably null
R1892:Ncstn UTSW 1 172071471 frame shift probably null
R1907:Ncstn UTSW 1 172072143 missense probably damaging 0.97
R3722:Ncstn UTSW 1 172067895 missense possibly damaging 0.50
R3876:Ncstn UTSW 1 172070073 missense probably benign 0.02
R3946:Ncstn UTSW 1 172067494 missense probably benign 0.00
R3969:Ncstn UTSW 1 172070009 missense probably damaging 1.00
R4108:Ncstn UTSW 1 172072544 missense probably damaging 1.00
R4597:Ncstn UTSW 1 172068256 nonsense probably null
R4998:Ncstn UTSW 1 172071520 missense possibly damaging 0.81
R5037:Ncstn UTSW 1 172068626 missense probably damaging 1.00
R5150:Ncstn UTSW 1 172067584 intron probably benign
R5444:Ncstn UTSW 1 172072839 missense possibly damaging 0.92
R5605:Ncstn UTSW 1 172081150 intron probably benign
R6675:Ncstn UTSW 1 172071528 missense probably damaging 1.00
R7268:Ncstn UTSW 1 172081263 missense possibly damaging 0.86
R7290:Ncstn UTSW 1 172072806 missense probably benign
R7871:Ncstn UTSW 1 172075456 missense probably benign 0.00
R7954:Ncstn UTSW 1 172075456 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGTAATTTCAGGAAATAGGAGCTTC -3'
(R):5'- GTGCATTCTCTTGAAGCAGGAG -3'

Sequencing Primer
(F):5'- GGAGCTTCCTAAAAATAGGGGG -3'
(R):5'- TCTCTTGAAGCAGGAGAAGGG -3'
Posted On2016-09-01