Incidental Mutation 'R5406:Ncstn'
ID 426261
Institutional Source Beutler Lab
Gene Symbol Ncstn
Ensembl Gene ENSMUSG00000003458
Gene Name nicastrin
Synonyms D1Dau13e, 9430068N19Rik, Nct, nicastrin
MMRRC Submission 042976-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R5406 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 171893580-171910356 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 171899731 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 317 (V317A)
Ref Sequence ENSEMBL: ENSMUSP00000003550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003550] [ENSMUST00000140643] [ENSMUST00000146137]
AlphaFold P57716
Predicted Effect probably benign
Transcript: ENSMUST00000003550
AA Change: V317A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000003550
Gene: ENSMUSG00000003458
AA Change: V317A

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Pfam:Peptidase_M28 254 468 2.9e-7 PFAM
Pfam:Nicastrin 273 498 1.6e-94 PFAM
transmembrane domain 669 691 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135928
Predicted Effect probably benign
Transcript: ENSMUST00000140643
SMART Domains Protein: ENSMUSP00000119128
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146137
SMART Domains Protein: ENSMUSP00000120663
Gene: ENSMUSG00000003458

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type I transmembrane glycoprotein that is an integral component of the multimeric gamma-secretase complex. The encoded protein cleaves integral membrane proteins, including Notch receptors and beta-amyloid precursor protein, and may be a stabilizing cofactor required for gamma-secretase complex assembly. The cleavage of beta-amyloid precursor protein yields amyloid beta peptide, the main component of the neuritic plaque and the hallmark lesion in the brains of patients with Alzheimer's disease; however, the nature of the encoded protein's role in Alzheimer's disease is not known for certain. Mutations in this gene are associated with familial acne inversa. A pseudogene of this gene is present on chromosome 21. Alternatively spliced transcript variants of this gene have been described, but the full-length nature of some of these variants has not been determined. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous mutant embryos die exhibiting morphological defects of the somites, yolk sac vasculature, neural tube, and pericardial sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 (GRCm39) V17D probably damaging Het
Abcb1a C A 5: 8,752,946 (GRCm39) Q566K probably damaging Het
Adam26a A T 8: 44,022,141 (GRCm39) C450S probably damaging Het
Adar C T 3: 89,643,418 (GRCm39) P433L probably damaging Het
Aldh1a2 G T 9: 71,162,403 (GRCm39) A151S possibly damaging Het
Arsk T A 13: 76,242,066 (GRCm39) H69L probably benign Het
Atf6b T A 17: 34,872,771 (GRCm39) Y600* probably null Het
Blk C A 14: 63,618,180 (GRCm39) G242V probably damaging Het
Bmt2 A T 6: 13,677,831 (GRCm39) M1K probably null Het
Catsperg1 G A 7: 28,884,948 (GRCm39) T891M probably damaging Het
Ccdc32 A C 2: 118,852,560 (GRCm39) S131A possibly damaging Het
Cdh8 A G 8: 99,923,002 (GRCm39) V298A probably damaging Het
Cfap54 T A 10: 92,837,720 (GRCm39) Q1060L probably benign Het
Cfap58 G A 19: 48,017,541 (GRCm39) M800I possibly damaging Het
Cntn5 A T 9: 9,833,465 (GRCm39) V362D probably damaging Het
Fkbpl G A 17: 34,864,303 (GRCm39) A24T probably benign Het
G2e3 T C 12: 51,419,449 (GRCm39) S699P probably damaging Het
Gbp4 G T 5: 105,267,387 (GRCm39) Q511K possibly damaging Het
Gdap2 T A 3: 100,098,991 (GRCm39) I361N probably damaging Het
Ino80c T A 18: 24,245,819 (GRCm39) H92L probably benign Het
Lipo4 A G 19: 33,480,618 (GRCm39) V250A probably benign Het
Llgl1 C T 11: 60,604,010 (GRCm39) R1055W probably damaging Het
Lrriq3 T C 3: 154,835,138 (GRCm39) probably null Het
Mmp1a A G 9: 7,467,294 (GRCm39) E290G probably damaging Het
Nfxl1 G A 5: 72,713,541 (GRCm39) T134I possibly damaging Het
Nup155 A T 15: 8,183,122 (GRCm39) probably null Het
Nup214 C A 2: 31,892,619 (GRCm39) P680T probably damaging Het
Or6c212 G A 10: 129,558,799 (GRCm39) L205F probably damaging Het
Or7h8 A G 9: 20,124,454 (GRCm39) K270E probably benign Het
Or8b12 A G 9: 37,657,943 (GRCm39) N171S probably benign Het
Or8b9 G A 9: 37,766,515 (GRCm39) V134I probably benign Het
Pkd2 T C 5: 104,628,198 (GRCm39) F424S probably damaging Het
Plb1 A G 5: 32,499,259 (GRCm39) D1074G probably damaging Het
Ppm1l T C 3: 69,224,927 (GRCm39) S10P possibly damaging Het
Rnf213 A G 11: 119,331,634 (GRCm39) H2281R probably damaging Het
Rpa2 G T 4: 132,503,559 (GRCm39) A3S probably benign Het
Sardh A G 2: 27,101,096 (GRCm39) V698A possibly damaging Het
Saxo2 A T 7: 82,284,586 (GRCm39) C91S probably benign Het
Slc3a2 T C 19: 8,685,406 (GRCm39) D198G probably damaging Het
Spata31d1d T A 13: 59,876,592 (GRCm39) E314D probably benign Het
Sptlc3 T C 2: 139,388,398 (GRCm39) V130A probably benign Het
Stpg3 C A 2: 25,103,580 (GRCm39) E115* probably null Het
Tbcd T A 11: 121,342,927 (GRCm39) D19E probably benign Het
Xrcc3 T C 12: 111,778,545 (GRCm39) D2G probably damaging Het
Other mutations in Ncstn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Ncstn APN 1 171,901,968 (GRCm39) missense probably benign 0.02
IGL02030:Ncstn APN 1 171,900,024 (GRCm39) splice site probably benign
IGL02470:Ncstn APN 1 171,910,166 (GRCm39) critical splice donor site probably null
IGL02498:Ncstn APN 1 171,896,159 (GRCm39) missense probably benign
morel UTSW 1 171,900,043 (GRCm39) missense probably damaging 0.99
Pig UTSW 1 171,899,092 (GRCm39) missense probably damaging 1.00
truffle UTSW 1 171,897,576 (GRCm39) missense probably damaging 1.00
R0048:Ncstn UTSW 1 171,897,528 (GRCm39) splice site probably benign
R0480:Ncstn UTSW 1 171,910,159 (GRCm39) splice site probably benign
R0648:Ncstn UTSW 1 171,895,454 (GRCm39) missense probably benign 0.01
R0792:Ncstn UTSW 1 171,899,072 (GRCm39) missense possibly damaging 0.95
R1330:Ncstn UTSW 1 171,899,092 (GRCm39) missense probably damaging 1.00
R1524:Ncstn UTSW 1 171,899,716 (GRCm39) missense possibly damaging 0.58
R1660:Ncstn UTSW 1 171,894,339 (GRCm39) missense possibly damaging 0.78
R1828:Ncstn UTSW 1 171,899,038 (GRCm39) frame shift probably null
R1892:Ncstn UTSW 1 171,899,038 (GRCm39) frame shift probably null
R1907:Ncstn UTSW 1 171,899,710 (GRCm39) missense probably damaging 0.97
R3722:Ncstn UTSW 1 171,895,462 (GRCm39) missense possibly damaging 0.50
R3876:Ncstn UTSW 1 171,897,640 (GRCm39) missense probably benign 0.02
R3946:Ncstn UTSW 1 171,895,061 (GRCm39) missense probably benign 0.00
R3969:Ncstn UTSW 1 171,897,576 (GRCm39) missense probably damaging 1.00
R4108:Ncstn UTSW 1 171,900,111 (GRCm39) missense probably damaging 1.00
R4597:Ncstn UTSW 1 171,895,823 (GRCm39) nonsense probably null
R4998:Ncstn UTSW 1 171,899,087 (GRCm39) missense possibly damaging 0.81
R5037:Ncstn UTSW 1 171,896,193 (GRCm39) missense probably damaging 1.00
R5150:Ncstn UTSW 1 171,895,151 (GRCm39) intron probably benign
R5444:Ncstn UTSW 1 171,900,406 (GRCm39) missense possibly damaging 0.92
R5605:Ncstn UTSW 1 171,908,717 (GRCm39) intron probably benign
R6675:Ncstn UTSW 1 171,899,095 (GRCm39) missense probably damaging 1.00
R7268:Ncstn UTSW 1 171,908,830 (GRCm39) missense possibly damaging 0.86
R7290:Ncstn UTSW 1 171,900,373 (GRCm39) missense probably benign
R7871:Ncstn UTSW 1 171,903,023 (GRCm39) missense probably benign 0.00
R8238:Ncstn UTSW 1 171,900,043 (GRCm39) missense probably damaging 0.99
R9462:Ncstn UTSW 1 171,899,707 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTAATTTCAGGAAATAGGAGCTTC -3'
(R):5'- GTGCATTCTCTTGAAGCAGGAG -3'

Sequencing Primer
(F):5'- GGAGCTTCCTAAAAATAGGGGG -3'
(R):5'- TCTCTTGAAGCAGGAGAAGGG -3'
Posted On 2016-09-01