Incidental Mutation 'R5406:Stpg3'
ID426262
Institutional Source Beutler Lab
Gene Symbol Stpg3
Ensembl Gene ENSMUSG00000036770
Gene Namesperm tail PG rich repeat containing 3
Synonyms4933433C11Rik
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location25212207-25214637 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 25213568 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 115 (E115*)
Ref Sequence ENSEMBL: ENSMUSP00000110003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043774] [ENSMUST00000059849] [ENSMUST00000114363]
Predicted Effect probably null
Transcript: ENSMUST00000043774
AA Change: E170*
SMART Domains Protein: ENSMUSP00000037603
Gene: ENSMUSG00000036770
AA Change: E170*

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 103 145 9.5e-4 PFAM
Pfam:SHIPPO-rpt 226 255 1.4e-3 PFAM
Pfam:SHIPPO-rpt 265 291 1.4e-3 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059849
SMART Domains Protein: ENSMUSP00000057731
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 107 578 3.5e-248 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082985
Predicted Effect probably null
Transcript: ENSMUST00000114363
AA Change: E115*
SMART Domains Protein: ENSMUSP00000110003
Gene: ENSMUSG00000036770
AA Change: E115*

DomainStartEndE-ValueType
Pfam:SHIPPO-rpt 48 79 2.8e-4 PFAM
Pfam:SHIPPO-rpt 110 136 1.2e-1 PFAM
Pfam:SHIPPO-rpt 152 200 3.5e-1 PFAM
Pfam:SHIPPO-rpt 210 248 1.9e-3 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124661
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128876
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138199
Predicted Effect probably benign
Transcript: ENSMUST00000140934
SMART Domains Protein: ENSMUSP00000115698
Gene: ENSMUSG00000013465

DomainStartEndE-ValueType
Pfam:COBRA1 40 204 9.7e-106 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149509
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155706
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205741
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Stpg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01116:Stpg3 APN 2 25213179 unclassified probably benign
IGL01450:Stpg3 APN 2 25214610 unclassified probably benign
R1413:Stpg3 UTSW 2 25213850 missense probably damaging 1.00
R1612:Stpg3 UTSW 2 25213854 missense probably benign 0.00
R3780:Stpg3 UTSW 2 25213863 missense probably benign 0.00
R3781:Stpg3 UTSW 2 25213863 missense probably benign 0.00
R4694:Stpg3 UTSW 2 25213297 missense probably damaging 0.96
R5029:Stpg3 UTSW 2 25214564 missense probably damaging 0.97
R7202:Stpg3 UTSW 2 25214574 missense probably damaging 1.00
R8458:Stpg3 UTSW 2 25213321 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGTACCCAGGAAGGATGTTATAG -3'
(R):5'- ACTATGTGGGCCAGGTAGAG -3'

Sequencing Primer
(F):5'- ACCCAGGAAGGATGTTATAGGTGTTG -3'
(R):5'- TAAGAGAAGGGGCCGCCTTG -3'
Posted On2016-09-01