Mutagenetix > Incidental Mutations

Incidental Mutation 'R5406:Nup214'

426264

Institutional Source

Beutler Lab

Gene Symbol

Nup214

Ensembl Gene

ENSMUSG00000001855

Gene Name

nucleoporin 214

Synonyms

CAN, D2H9S46E

MMRRC Submission

042976-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

31974436-32053975 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 32002607 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Threonine at position 680 (P680T)

Ref Sequence

ENSEMBL: ENSMUSP00000066492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065398] [ENSMUST00000126301]

Predicted Effect

probably damaging
Transcript: ENSMUST00000065398
AA Change: P680T

PolyPhen 2 Score 0.958 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000066492
Gene: ENSMUSG00000001855
AA Change: P680T

Domain	Start	End	E-Value	Type
WD40	138	178	2.48e0	SMART
WD40	182	220	2.67e-1	SMART
low complexity region	428	441	N/A	INTRINSIC
low complexity region	449	467	N/A	INTRINSIC
low complexity region	474	493	N/A	INTRINSIC
low complexity region	529	546	N/A	INTRINSIC
low complexity region	620	640	N/A	INTRINSIC
low complexity region	645	656	N/A	INTRINSIC
coiled coil region	853	881	N/A	INTRINSIC
internal_repeat_1	969	993	1.13e-9	PROSPERO
internal_repeat_1	985	1009	1.13e-9	PROSPERO
low complexity region	1011	1026	N/A	INTRINSIC
low complexity region	1049	1064	N/A	INTRINSIC
low complexity region	1093	1111	N/A	INTRINSIC
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1226	1248	N/A	INTRINSIC
low complexity region	1279	1296	N/A	INTRINSIC
low complexity region	1300	1311	N/A	INTRINSIC
low complexity region	1391	1426	N/A	INTRINSIC
low complexity region	1438	1454	N/A	INTRINSIC
low complexity region	1458	1505	N/A	INTRINSIC
low complexity region	1559	1573	N/A	INTRINSIC
low complexity region	1611	1642	N/A	INTRINSIC
low complexity region	1658	1670	N/A	INTRINSIC
low complexity region	1686	1715	N/A	INTRINSIC
low complexity region	1733	1748	N/A	INTRINSIC
low complexity region	1771	1783	N/A	INTRINSIC
low complexity region	1799	1832	N/A	INTRINSIC
low complexity region	1853	1872	N/A	INTRINSIC
low complexity region	1877	1886	N/A	INTRINSIC
low complexity region	1898	1910	N/A	INTRINSIC
low complexity region	1925	1934	N/A	INTRINSIC
low complexity region	1969	1995	N/A	INTRINSIC
low complexity region	2007	2032	N/A	INTRINSIC
low complexity region	2048	2076	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000126301
AA Change: P36T

PolyPhen 2 Score 0.095 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000141436
Gene: ENSMUSG00000001855
AA Change: P36T

Domain	Start	End	E-Value	Type
low complexity region	1	12	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153096

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene is a member of the FG-repeat-containing nucleoporins. The protein encoded by this gene is localized to the cytoplasmic face of the nuclear pore complex where it is required for proper cell cycle progression and nucleocytoplasmic transport. The 3' portion of this gene forms a fusion gene with the DEK gene on chromosome 6 in a t(6,9) translocation associated with acute myeloid leukemia and myelodysplastic syndrome. Alternative splicing of this gene results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Embryos homozygous for a null mutation die between 4.0 and 4.5 dpc, following depletion of maternally-derived gene product. In vitro, cultured 3.5-dpc mutant embryos arrest in the G2 phase, and show blastocoel contraction with defects in NLS-mediated protein import and polyadenylated RNA export. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,387	V17D	probably damaging	Het
Abcb1a	C	A	5: 8,702,946	Q566K	probably damaging	Het
Adam26a	A	T	8: 43,569,104	C450S	probably damaging	Het
Adar	C	T	3: 89,736,111	P433L	probably damaging	Het
Aldh1a2	G	T	9: 71,255,121	A151S	possibly damaging	Het
Arsk	T	A	13: 76,093,947	H69L	probably benign	Het
Atf6b	T	A	17: 34,653,797	Y600*	probably null	Het
Blk	C	A	14: 63,380,731	G242V	probably damaging	Het
Bmt2	A	T	6: 13,677,832	M1K	probably null	Het
Catsperg1	G	A	7: 29,185,523	T891M	probably damaging	Het
Ccdc32	A	C	2: 119,022,079	S131A	possibly damaging	Het
Cdh8	A	G	8: 99,196,370	V298A	probably damaging	Het
Cfap54	T	A	10: 93,001,858	Q1060L	probably benign	Het
Cfap58	G	A	19: 48,029,102	M800I	possibly damaging	Het
Cntn5	A	T	9: 9,833,460	V362D	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
G2e3	T	C	12: 51,372,666	S699P	probably damaging	Het
Gbp4	G	T	5: 105,119,521	Q511K	possibly damaging	Het
Gdap2	T	A	3: 100,191,675	I361N	probably damaging	Het
Ino80c	T	A	18: 24,112,762	H92L	probably benign	Het
Lipo4	A	G	19: 33,503,218	V250A	probably benign	Het
Llgl1	C	T	11: 60,713,184	R1055W	probably damaging	Het
Lrriq3	T	C	3: 155,129,501		probably null	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Ncstn	A	G	1: 172,072,164	V317A	probably benign	Het
Nfxl1	G	A	5: 72,556,198	T134I	possibly damaging	Het
Nup155	A	T	15: 8,153,638		probably null	Het
Olfr805	G	A	10: 129,722,930	L205F	probably damaging	Het
Olfr871	A	G	9: 20,213,158	K270E	probably benign	Het
Olfr874	A	G	9: 37,746,647	N171S	probably benign	Het
Olfr877	G	A	9: 37,855,219	V134I	probably benign	Het
Pkd2	T	C	5: 104,480,332	F424S	probably damaging	Het
Plb1	A	G	5: 32,341,915	D1074G	probably damaging	Het
Ppm1l	T	C	3: 69,317,594	S10P	possibly damaging	Het
Rnf213	A	G	11: 119,440,808	H2281R	probably damaging	Het
Rpa2	G	T	4: 132,776,248	A3S	probably benign	Het
Sardh	A	G	2: 27,211,084	V698A	possibly damaging	Het
Saxo2	A	T	7: 82,635,378	C91S	probably benign	Het
Slc3a2	T	C	19: 8,708,042	D198G	probably damaging	Het
Spata31d1d	T	A	13: 59,728,778	E314D	probably benign	Het
Sptlc3	T	C	2: 139,546,478	V130A	probably benign	Het
Stpg3	C	A	2: 25,213,568	E115*	probably null	Het
Tbcd	T	A	11: 121,452,101	D19E	probably benign	Het
Xrcc3	T	C	12: 111,812,111	D2G	probably damaging	Het

Other mutations in Nup214

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00490:Nup214	APN	2	32033979	missense	probably damaging	1.00
IGL00649:Nup214	APN	2	32006721	missense	probably benign	0.27
IGL01149:Nup214	APN	2	32034700	missense	probably damaging	1.00
IGL01360:Nup214	APN	2	32038178	unclassified	probably benign
IGL01409:Nup214	APN	2	32026931	splice site	probably null
IGL01530:Nup214	APN	2	32033721	missense	probably benign
IGL01554:Nup214	APN	2	32051072	nonsense	probably null
IGL01944:Nup214	APN	2	32034959	nonsense	probably null
IGL02296:Nup214	APN	2	31988188	missense	possibly damaging	0.65
IGL02563:Nup214	APN	2	31977860	missense	probably damaging	1.00
IGL02688:Nup214	APN	2	32031275	missense	probably benign
IGL02858:Nup214	APN	2	32010372	splice site	probably benign
IGL02953:Nup214	APN	2	31988229	missense	possibly damaging	0.87
IGL03090:Nup214	APN	2	32018242	missense	probably benign	0.01
IGL03124:Nup214	APN	2	31996440	missense	probably benign	0.27
IGL03225:Nup214	APN	2	32034411	missense	probably damaging	1.00
IGL03375:Nup214	APN	2	32010221	missense	probably damaging	0.97
Des_moines	UTSW	2	31980584	splice site	probably null
ANU74:Nup214	UTSW	2	32034966	missense	probably damaging	0.99
R0035:Nup214	UTSW	2	31990367	splice site	probably null
R0243:Nup214	UTSW	2	31998057	splice site	probably benign
R0270:Nup214	UTSW	2	32034814	missense	probably damaging	0.96
R0358:Nup214	UTSW	2	32004300	splice site	probably null
R1168:Nup214	UTSW	2	32025301	missense	probably benign
R1242:Nup214	UTSW	2	31977770	missense	probably benign	0.00
R1481:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1482:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1579:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1580:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1581:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1610:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R1894:Nup214	UTSW	2	31996380	missense	possibly damaging	0.66
R2146:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R2149:Nup214	UTSW	2	32034466	missense	probably damaging	1.00
R2293:Nup214	UTSW	2	32026875	missense	probably benign
R2924:Nup214	UTSW	2	31998003	missense	probably damaging	1.00
R2925:Nup214	UTSW	2	31998003	missense	probably damaging	1.00
R3037:Nup214	UTSW	2	31976620	missense	probably benign	0.00
R3426:Nup214	UTSW	2	32033403	missense	probably damaging	0.97
R3799:Nup214	UTSW	2	32034682	missense	probably damaging	1.00
R3843:Nup214	UTSW	2	32051100	missense	probably damaging	1.00
R4323:Nup214	UTSW	2	31994684	missense	probably benign
R4353:Nup214	UTSW	2	31977917	critical splice donor site	probably null
R4601:Nup214	UTSW	2	31997965	missense	probably benign	0.36
R4626:Nup214	UTSW	2	32033404	missense	possibly damaging	0.92
R4874:Nup214	UTSW	2	31980584	splice site	probably null
R4938:Nup214	UTSW	2	31983159	missense	probably benign	0.00
R4939:Nup214	UTSW	2	31983159	missense	probably benign	0.00
R5027:Nup214	UTSW	2	31991317	missense	probably damaging	1.00
R5358:Nup214	UTSW	2	32017146	missense	unknown
R5507:Nup214	UTSW	2	31988176	missense	possibly damaging	0.87
R5695:Nup214	UTSW	2	32034373	missense	probably damaging	1.00
R5744:Nup214	UTSW	2	32010296	missense	probably damaging	0.97
R5908:Nup214	UTSW	2	31991341	missense	probably benign	0.03
R5967:Nup214	UTSW	2	31979778	missense	possibly damaging	0.52
R6140:Nup214	UTSW	2	32051796	missense	possibly damaging	0.92
R6243:Nup214	UTSW	2	32002932	missense	possibly damaging	0.81
R6488:Nup214	UTSW	2	31991372	missense	possibly damaging	0.93
R6934:Nup214	UTSW	2	31982671	nonsense	probably null
R6970:Nup214	UTSW	2	32051798	missense	probably damaging	1.00
R7028:Nup214	UTSW	2	32034156	missense	probably benign	0.22
R7114:Nup214	UTSW	2	32025244	missense	possibly damaging	0.83
R7120:Nup214	UTSW	2	32051042	missense	probably benign	0.07
R7249:Nup214	UTSW	2	31988233	missense	possibly damaging	0.92
R7821:Nup214	UTSW	2	32026905	missense	possibly damaging	0.83
R8026:Nup214	UTSW	2	32033350	missense	possibly damaging	0.55
R8264:Nup214	UTSW	2	31994726	missense	possibly damaging	0.79
R8284:Nup214	UTSW	2	31996446	missense	possibly damaging	0.83
R8356:Nup214	UTSW	2	32039360	missense	probably benign	0.05
R8397:Nup214	UTSW	2	31990254	missense	probably damaging	0.96
R8456:Nup214	UTSW	2	32039360	missense	probably benign	0.05
RF015:Nup214	UTSW	2	32034706	missense	probably benign	0.00
X0026:Nup214	UTSW	2	32020306	missense	possibly damaging	0.46
X0065:Nup214	UTSW	2	32042476	missense	probably damaging	1.00
Z1088:Nup214	UTSW	2	32011223	missense	probably benign	0.27
Z1176:Nup214	UTSW	2	32010258	missense	possibly damaging	0.66
Z1176:Nup214	UTSW	2	32034225	nonsense	probably null
Z1177:Nup214	UTSW	2	31997959	missense	possibly damaging	0.83

Predicted Primers

PCR Primer
(F):5'- GCATCCTCTACAAATTGGAGACC -3'
(R):5'- AGAAAGGCCACTGCTTCTAC -3'

Sequencing Primer
(F):5'- TCTACAAATTGGAGACCCAGTG -3'
(R):5'- TCCAGGCCAGGACCTAATGTTAG -3'

Posted On

2016-09-01