Mutagenetix > Incidental Mutations

Incidental Mutation 'R5406:Sptlc3'

426266

Institutional Source

Beutler Lab

Gene Symbol

Sptlc3

Ensembl Gene

ENSMUSG00000039092

Gene Name

serine palmitoyltransferase, long chain base subunit 3

Synonyms

MMRRC Submission

042976-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.093) question?

Stock #

R5406 (G1)

Quality Score

173

Status

Not validated

Chromosome

Chromosomal Location

139493913-139637674 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 139546478 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 130 (V130A)

Ref Sequence

ENSEMBL: ENSMUSP00000105710 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000047370] [ENSMUST00000110083]

AlphaFold

Q8BG54

Predicted Effect

probably benign
Transcript: ENSMUST00000047370
AA Change: V130A

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000048313
Gene: ENSMUSG00000039092
AA Change: V130A

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110083
AA Change: V130A

PolyPhen 2 Score 0.258 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000105710
Gene: ENSMUSG00000039092
AA Change: V130A

Domain	Start	End	E-Value	Type
transmembrane domain	60	79	N/A	INTRINSIC
Pfam:Aminotran_1_2	160	520	4.8e-59	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134801

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SPTLC3 gene encodes an isoform of the third subunit of serine palmitoyltransferase (SPT; EC 2.3.1.50), which catalyzes the rate-limiting step of the de novo synthesis of sphingolipids (Hornemann et al., 2006 [PubMed 17023427]). SPT contains 2 main subunits: the common SPTLC1 subunit (MIM 605712) and either SPTLC2 (MIM 605713) or its isoform SPTLC2L (SPTLC3), depending on the tissue in which biosynthesis occurs (Hornemann et al., 2006 [PubMed 17023427]). There are also 2 highly related isoforms of a third subunit, SSSPTA (MIM 613540) and SSSPTB (MIM 610412), that confer acyl-CoA preference of the SPT enzyme and are essential for maximal enzyme activity (Han et al., 2009 [PubMed 19416851]).[supplied by OMIM, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,387	V17D	probably damaging	Het
Abcb1a	C	A	5: 8,702,946	Q566K	probably damaging	Het
Adam26a	A	T	8: 43,569,104	C450S	probably damaging	Het
Adar	C	T	3: 89,736,111	P433L	probably damaging	Het
Aldh1a2	G	T	9: 71,255,121	A151S	possibly damaging	Het
Arsk	T	A	13: 76,093,947	H69L	probably benign	Het
Atf6b	T	A	17: 34,653,797	Y600*	probably null	Het
Blk	C	A	14: 63,380,731	G242V	probably damaging	Het
Bmt2	A	T	6: 13,677,832	M1K	probably null	Het
Catsperg1	G	A	7: 29,185,523	T891M	probably damaging	Het
Ccdc32	A	C	2: 119,022,079	S131A	possibly damaging	Het
Cdh8	A	G	8: 99,196,370	V298A	probably damaging	Het
Cfap54	T	A	10: 93,001,858	Q1060L	probably benign	Het
Cfap58	G	A	19: 48,029,102	M800I	possibly damaging	Het
Cntn5	A	T	9: 9,833,460	V362D	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
G2e3	T	C	12: 51,372,666	S699P	probably damaging	Het
Gbp4	G	T	5: 105,119,521	Q511K	possibly damaging	Het
Gdap2	T	A	3: 100,191,675	I361N	probably damaging	Het
Ino80c	T	A	18: 24,112,762	H92L	probably benign	Het
Lipo4	A	G	19: 33,503,218	V250A	probably benign	Het
Llgl1	C	T	11: 60,713,184	R1055W	probably damaging	Het
Lrriq3	T	C	3: 155,129,501		probably null	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Ncstn	A	G	1: 172,072,164	V317A	probably benign	Het
Nfxl1	G	A	5: 72,556,198	T134I	possibly damaging	Het
Nup155	A	T	15: 8,153,638		probably null	Het
Nup214	C	A	2: 32,002,607	P680T	probably damaging	Het
Olfr805	G	A	10: 129,722,930	L205F	probably damaging	Het
Olfr871	A	G	9: 20,213,158	K270E	probably benign	Het
Olfr874	A	G	9: 37,746,647	N171S	probably benign	Het
Olfr877	G	A	9: 37,855,219	V134I	probably benign	Het
Pkd2	T	C	5: 104,480,332	F424S	probably damaging	Het
Plb1	A	G	5: 32,341,915	D1074G	probably damaging	Het
Ppm1l	T	C	3: 69,317,594	S10P	possibly damaging	Het
Rnf213	A	G	11: 119,440,808	H2281R	probably damaging	Het
Rpa2	G	T	4: 132,776,248	A3S	probably benign	Het
Sardh	A	G	2: 27,211,084	V698A	possibly damaging	Het
Saxo2	A	T	7: 82,635,378	C91S	probably benign	Het
Slc3a2	T	C	19: 8,708,042	D198G	probably damaging	Het
Spata31d1d	T	A	13: 59,728,778	E314D	probably benign	Het
Stpg3	C	A	2: 25,213,568	E115*	probably null	Het
Tbcd	T	A	11: 121,452,101	D19E	probably benign	Het
Xrcc3	T	C	12: 111,812,111	D2G	probably damaging	Het

Other mutations in Sptlc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01392:Sptlc3	APN	2	139546421	missense	possibly damaging	0.55
IGL01537:Sptlc3	APN	2	139589695	missense	possibly damaging	0.95
IGL01996:Sptlc3	APN	2	139581504	splice site	probably benign
IGL02512:Sptlc3	APN	2	139547203	missense	probably damaging	1.00
IGL03278:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
IGL03286:Sptlc3	APN	2	139589659	missense	probably damaging	1.00
R0266:Sptlc3	UTSW	2	139596037	missense	possibly damaging	0.93
R0362:Sptlc3	UTSW	2	139546555	splice site	probably benign
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1464:Sptlc3	UTSW	2	139547234	missense	probably benign	0.00
R1494:Sptlc3	UTSW	2	139589560	missense	possibly damaging	0.58
R1847:Sptlc3	UTSW	2	139625923	missense	probably benign	0.08
R1919:Sptlc3	UTSW	2	139566675	missense	possibly damaging	0.66
R2093:Sptlc3	UTSW	2	139625874	missense	possibly damaging	0.89
R2396:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R2972:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2973:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R2974:Sptlc3	UTSW	2	139589661	missense	probably damaging	1.00
R4601:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4602:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4610:Sptlc3	UTSW	2	139636680	missense	probably benign	0.01
R4745:Sptlc3	UTSW	2	139547167	missense	probably damaging	1.00
R4779:Sptlc3	UTSW	2	139589589	missense	probably benign	0.04
R4992:Sptlc3	UTSW	2	139596003	missense	probably benign	0.04
R5162:Sptlc3	UTSW	2	139631343	missense	probably benign	0.11
R5401:Sptlc3	UTSW	2	139636723	missense	possibly damaging	0.75
R5642:Sptlc3	UTSW	2	139546408	missense	probably damaging	0.96
R5840:Sptlc3	UTSW	2	139547206	missense	probably damaging	1.00
R6057:Sptlc3	UTSW	2	139581613	missense	probably damaging	0.99
R6376:Sptlc3	UTSW	2	139636772	missense	probably benign	0.21
R6852:Sptlc3	UTSW	2	139566586	missense	probably benign	0.44
R7026:Sptlc3	UTSW	2	139537688	missense	probably benign
R7412:Sptlc3	UTSW	2	139589617	missense	possibly damaging	0.75
R7516:Sptlc3	UTSW	2	139589518	missense	probably benign	0.11
R7733:Sptlc3	UTSW	2	139631368	missense	possibly damaging	0.77
R7826:Sptlc3	UTSW	2	139547195	missense	probably benign	0.44
R7949:Sptlc3	UTSW	2	139625875	missense	possibly damaging	0.81
R9224:Sptlc3	UTSW	2	139494234	missense	probably benign	0.17
R9237:Sptlc3	UTSW	2	139566685	missense	probably benign	0.40
R9319:Sptlc3	UTSW	2	139636810	missense	possibly damaging	0.65
R9330:Sptlc3	UTSW	2	139546503	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CATTGATTAACCAGGCCCTTCC -3'
(R):5'- CCACCATAGCATGAGAAATTGC -3'

Sequencing Primer
(F):5'- ATTGATTAACCAGGCCCTTCCTCTTC -3'
(R):5'- GCTGAGTAGTAGAAGATCAACCTC -3'

Posted On

2016-09-01