Incidental Mutation 'R5406:Ppm1l'
ID426267
Institutional Source Beutler Lab
Gene Symbol Ppm1l
Ensembl Gene ENSMUSG00000027784
Gene Nameprotein phosphatase 1 (formerly 2C)-like
Synonyms5930404J21Rik, Pp2ce, PP2C-epsilon
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location69316861-69560802 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 69317594 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 10 (S10P)
Ref Sequence ENSEMBL: ENSMUSP00000029355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029355]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029355
AA Change: S10P

PolyPhen 2 Score 0.662 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000029355
Gene: ENSMUSG00000027784
AA Change: S10P

DomainStartEndE-ValueType
PP2Cc 77 349 3.17e-75 SMART
PP2C_SIG 103 351 1.28e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164501
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a magnesium or manganese-requiring phosphatase that is involved in several signaling pathways. The encoded protein downregulates apoptosis signal-regulating kinase 1, a protein that initiates a signaling cascade that leads to apoptosis when cells are subjected to cytotoxic stresses. This protein also is an endoplasmic reticulum transmembrane protein that helps regulate ceramide transport from the endoplasmic reticulum to the Golgi apparatus. Finally, this gene may be involved in adiposity since it is upregulated in adipose tissues. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a null allele show increased body weight and total fat mass, higher blood pressure and plasma glucose levels, lower free fatty acid levels and improved glucose tolerance. Homozygotes for another null allele show postnatal lethality, motor deficits and altered forebrain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Ppm1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Ppm1l APN 3 69317950 missense probably damaging 1.00
IGL02834:Ppm1l APN 3 69549343 missense probably damaging 1.00
R0270:Ppm1l UTSW 3 69317976 splice site probably benign
R0310:Ppm1l UTSW 3 69549461 missense probably benign 0.39
R0557:Ppm1l UTSW 3 69497901 missense probably benign 0.39
R1577:Ppm1l UTSW 3 69553070 missense probably damaging 1.00
R3508:Ppm1l UTSW 3 69549480 missense possibly damaging 0.81
R4750:Ppm1l UTSW 3 69549328 missense probably damaging 0.99
R4864:Ppm1l UTSW 3 69542511 intron probably benign
R5007:Ppm1l UTSW 3 69317598 missense probably damaging 1.00
R6168:Ppm1l UTSW 3 69549407 missense probably damaging 1.00
R6256:Ppm1l UTSW 3 69497897 missense probably benign
R6474:Ppm1l UTSW 3 69553041 missense probably damaging 0.99
R6517:Ppm1l UTSW 3 69317583 missense probably damaging 0.98
R6949:Ppm1l UTSW 3 69549403 missense possibly damaging 0.90
R7029:Ppm1l UTSW 3 69553066 missense probably benign 0.16
R7086:Ppm1l UTSW 3 69317853 missense probably damaging 1.00
R7312:Ppm1l UTSW 3 69317711 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAGGGAAACTGCCATCGTTC -3'
(R):5'- TCAAGTCCTCCAAGACGATCG -3'

Sequencing Primer
(F):5'- GAAACTGCCATCGTTCTGGAC -3'
(R):5'- AGACGATCGTTCTGCATAATCTCGG -3'
Posted On2016-09-01