Incidental Mutation 'R5406:Abcb1a'
ID426270
Institutional Source Beutler Lab
Gene Symbol Abcb1a
Ensembl Gene ENSMUSG00000040584
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 1A
SynonymsPgp, mdr-3, Pgy-3, MDR3, P-glycoprotein, Evi32, P-gp, Mdr1a, Pgy3, multiple drug resistant 1a
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location8660077-8748575 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 8702946 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 566 (Q566K)
Ref Sequence ENSEMBL: ENSMUSP00000041204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047753]
PDB Structure
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structure of P-glycoprotein Reveals a Molecular Basis for Poly-Specific Drug Binding [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structures of P-glycoprotein reveal its conformational flexibility and an epitope on the nucleotide-binding domain [X-RAY DIFFRACTION]
Structure of Mouse P-Glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-RRR [X-RAY DIFFRACTION]
Corrected Structure of Mouse P-glycoprotein bound to QZ59-SSS [X-RAY DIFFRACTION]
>> 5 additional structures at PDB <<
Predicted Effect probably damaging
Transcript: ENSMUST00000047753
AA Change: Q566K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000041204
Gene: ENSMUSG00000040584
AA Change: Q566K

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
Pfam:ABC_membrane 50 339 8.3e-97 PFAM
AAA 415 607 1.22e-20 SMART
Pfam:ABC_membrane 707 982 4.8e-79 PFAM
AAA 1058 1246 8.85e-18 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. This gene encodes a p-glycoprotein which actively transports a variety of hydrophobic amphipathic drugs and plays a major role in the blood-brain barrier permeability of certain drugs. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations in this gene result in increased sensitivity to various drugs, including avermectins and vinblastine. Mice with a null allele develop spontanous colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Abcb1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Abcb1a APN 5 8686257 missense probably benign 0.01
IGL00898:Abcb1a APN 5 8733690 missense probably damaging 0.97
IGL01064:Abcb1a APN 5 8732388 missense possibly damaging 0.65
IGL01118:Abcb1a APN 5 8674687 missense probably damaging 1.00
IGL01150:Abcb1a APN 5 8702550 missense possibly damaging 0.90
IGL01584:Abcb1a APN 5 8698637 missense possibly damaging 0.95
IGL01654:Abcb1a APN 5 8715065 critical splice donor site probably null
IGL01820:Abcb1a APN 5 8715896 splice site probably benign
IGL02499:Abcb1a APN 5 8726807 missense possibly damaging 0.67
IGL02711:Abcb1a APN 5 8723245 splice site probably null
IGL02954:Abcb1a APN 5 8732341 missense probably benign 0.00
IGL03018:Abcb1a APN 5 8702451 missense probably damaging 0.99
IGL03119:Abcb1a APN 5 8714887 missense probably benign 0.00
IGL03292:Abcb1a APN 5 8715827 missense possibly damaging 0.93
IGL03338:Abcb1a APN 5 8694153 missense probably damaging 1.00
R0418:Abcb1a UTSW 5 8713281 missense probably damaging 0.96
R0559:Abcb1a UTSW 5 8698535 missense probably benign 0.01
R0595:Abcb1a UTSW 5 8740417 missense probably damaging 1.00
R0599:Abcb1a UTSW 5 8698539 missense probably benign 0.13
R0811:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0812:Abcb1a UTSW 5 8713229 missense probably damaging 1.00
R0894:Abcb1a UTSW 5 8674856 splice site probably benign
R0948:Abcb1a UTSW 5 8740621 splice site probably null
R1292:Abcb1a UTSW 5 8713343 missense probably benign 0.00
R1318:Abcb1a UTSW 5 8701621 missense probably benign 0.31
R1459:Abcb1a UTSW 5 8702920 missense probably damaging 1.00
R1489:Abcb1a UTSW 5 8686300 critical splice donor site probably null
R1514:Abcb1a UTSW 5 8674791 missense possibly damaging 0.88
R2100:Abcb1a UTSW 5 8713202 missense probably damaging 1.00
R2409:Abcb1a UTSW 5 8738747 missense probably benign 0.30
R2844:Abcb1a UTSW 5 8686164 missense probably benign 0.02
R3709:Abcb1a UTSW 5 8738738 missense probably benign 0.03
R3755:Abcb1a UTSW 5 8747403 missense possibly damaging 0.95
R4193:Abcb1a UTSW 5 8715068 splice site probably null
R4401:Abcb1a UTSW 5 8702390 missense possibly damaging 0.54
R4463:Abcb1a UTSW 5 8719981 splice site probably benign
R4539:Abcb1a UTSW 5 8715793 missense probably benign
R4635:Abcb1a UTSW 5 8714927 missense probably benign
R4740:Abcb1a UTSW 5 8702280 critical splice donor site probably null
R4757:Abcb1a UTSW 5 8737632 missense probably damaging 0.99
R4764:Abcb1a UTSW 5 8715732 splice site probably null
R4792:Abcb1a UTSW 5 8746657 critical splice donor site probably null
R4829:Abcb1a UTSW 5 8723214 missense probably damaging 1.00
R4935:Abcb1a UTSW 5 8737773 critical splice donor site probably null
R5140:Abcb1a UTSW 5 8702154 missense probably damaging 0.99
R5181:Abcb1a UTSW 5 8714937 missense probably benign
R5355:Abcb1a UTSW 5 8726873 missense probably damaging 1.00
R5496:Abcb1a UTSW 5 8674818 missense probably benign
R5557:Abcb1a UTSW 5 8714949 missense probably benign 0.01
R5572:Abcb1a UTSW 5 8715108 splice site probably null
R5702:Abcb1a UTSW 5 8737752 missense probably benign 0.15
R5753:Abcb1a UTSW 5 8723160 missense probably damaging 0.98
R5769:Abcb1a UTSW 5 8683426 missense probably benign 0.01
R5895:Abcb1a UTSW 5 8702216 missense probably damaging 1.00
R6536:Abcb1a UTSW 5 8719030 missense probably benign 0.01
R6555:Abcb1a UTSW 5 8702468 missense probably damaging 0.97
R6798:Abcb1a UTSW 5 8732364 missense probably damaging 1.00
R6875:Abcb1a UTSW 5 8701628 missense probably benign 0.28
R7000:Abcb1a UTSW 5 8702823 missense probably benign 0.19
R7102:Abcb1a UTSW 5 8694072 missense probably benign 0.01
R7172:Abcb1a UTSW 5 8702399 missense probably benign 0.00
R7313:Abcb1a UTSW 5 8723187 missense probably damaging 1.00
R7513:Abcb1a UTSW 5 8715771 nonsense probably null
R7718:Abcb1a UTSW 5 8715788 missense probably damaging 1.00
R7816:Abcb1a UTSW 5 8686132 missense possibly damaging 0.56
R7829:Abcb1a UTSW 5 8698623 missense probably benign 0.06
R7943:Abcb1a UTSW 5 8686222 missense probably benign
R8040:Abcb1a UTSW 5 8715035 missense probably benign 0.00
R8086:Abcb1a UTSW 5 8674833 missense probably benign
R8271:Abcb1a UTSW 5 8686212 missense probably benign 0.41
R8367:Abcb1a UTSW 5 8686221 missense probably benign 0.00
R8520:Abcb1a UTSW 5 8685346 missense possibly damaging 0.67
Z1177:Abcb1a UTSW 5 8746544 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCCACACCCTATCAAATAGTGGTA -3'
(R):5'- AACGGAAATTGAACACGCAA -3'

Sequencing Primer
(F):5'- GCAATTTGACACCCTGGT -3'
(R):5'- AAAAAGATTGTGGAAGACTGGTG -3'
Posted On2016-09-01