Mutagenetix > Incidental Mutations

Incidental Mutation 'R5406:Plb1'

426271

Institutional Source

Beutler Lab

Gene Symbol

Plb1

Ensembl Gene

ENSMUSG00000029134

Gene Name

phospholipase B1

Synonyms

4930539A06Rik, 4632413E21Rik, 4930433E17Rik

MMRRC Submission

042976-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.056) question?

Stock #

R5406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32232708-32366520 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 32341915 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 1074 (D1074G)

Ref Sequence

ENSEMBL: ENSMUSP00000144040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000101376] [ENSMUST00000202220]

Predicted Effect

probably damaging
Transcript: ENSMUST00000101376
AA Change: D1074G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000098927
Gene: ENSMUSG00000029134
AA Change: D1074G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202220
AA Change: D1074G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000144040
Gene: ENSMUSG00000029134
AA Change: D1074G

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
low complexity region	57	69	N/A	INTRINSIC
Pfam:Lipase_GDSL	398	672	4e-20	PFAM
Pfam:Lipase_GDSL	745	1019	1.7e-17	PFAM
Pfam:Lipase_GDSL	1101	1367	4.6e-15	PFAM
transmembrane domain	1420	1442	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202688

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane-associated phospholipase that displays lysophospholipase and phospholipase A2 activities through removal of sn-1 and sn-2 fatty acids of glycerophospholipids. In addition, it displays lipase and retinyl ester hydrolase activities. The encoded protein is highly conserved and is composed of a large, glycosylated extracellular domain composed of four tandem homologous domains, followed by a hydrophobic segment that anchors the enzyme to the membrane and a short C-terminal cytoplasmic tail. This gene has been identified as a candidate rheumatoid arthritis risk gene. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,387	V17D	probably damaging	Het
Abcb1a	C	A	5: 8,702,946	Q566K	probably damaging	Het
Adam26a	A	T	8: 43,569,104	C450S	probably damaging	Het
Adar	C	T	3: 89,736,111	P433L	probably damaging	Het
Aldh1a2	G	T	9: 71,255,121	A151S	possibly damaging	Het
Arsk	T	A	13: 76,093,947	H69L	probably benign	Het
Atf6b	T	A	17: 34,653,797	Y600*	probably null	Het
Blk	C	A	14: 63,380,731	G242V	probably damaging	Het
Bmt2	A	T	6: 13,677,832	M1K	probably null	Het
Catsperg1	G	A	7: 29,185,523	T891M	probably damaging	Het
Ccdc32	A	C	2: 119,022,079	S131A	possibly damaging	Het
Cdh8	A	G	8: 99,196,370	V298A	probably damaging	Het
Cfap54	T	A	10: 93,001,858	Q1060L	probably benign	Het
Cfap58	G	A	19: 48,029,102	M800I	possibly damaging	Het
Cntn5	A	T	9: 9,833,460	V362D	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
G2e3	T	C	12: 51,372,666	S699P	probably damaging	Het
Gbp4	G	T	5: 105,119,521	Q511K	possibly damaging	Het
Gdap2	T	A	3: 100,191,675	I361N	probably damaging	Het
Ino80c	T	A	18: 24,112,762	H92L	probably benign	Het
Lipo4	A	G	19: 33,503,218	V250A	probably benign	Het
Llgl1	C	T	11: 60,713,184	R1055W	probably damaging	Het
Lrriq3	T	C	3: 155,129,501		probably null	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Ncstn	A	G	1: 172,072,164	V317A	probably benign	Het
Nfxl1	G	A	5: 72,556,198	T134I	possibly damaging	Het
Nup155	A	T	15: 8,153,638		probably null	Het
Nup214	C	A	2: 32,002,607	P680T	probably damaging	Het
Olfr805	G	A	10: 129,722,930	L205F	probably damaging	Het
Olfr871	A	G	9: 20,213,158	K270E	probably benign	Het
Olfr874	A	G	9: 37,746,647	N171S	probably benign	Het
Olfr877	G	A	9: 37,855,219	V134I	probably benign	Het
Pkd2	T	C	5: 104,480,332	F424S	probably damaging	Het
Ppm1l	T	C	3: 69,317,594	S10P	possibly damaging	Het
Rnf213	A	G	11: 119,440,808	H2281R	probably damaging	Het
Rpa2	G	T	4: 132,776,248	A3S	probably benign	Het
Sardh	A	G	2: 27,211,084	V698A	possibly damaging	Het
Saxo2	A	T	7: 82,635,378	C91S	probably benign	Het
Slc3a2	T	C	19: 8,708,042	D198G	probably damaging	Het
Spata31d1d	T	A	13: 59,728,778	E314D	probably benign	Het
Sptlc3	T	C	2: 139,546,478	V130A	probably benign	Het
Stpg3	C	A	2: 25,213,568	E115*	probably null	Het
Tbcd	T	A	11: 121,452,101	D19E	probably benign	Het
Xrcc3	T	C	12: 111,812,111	D2G	probably damaging	Het

Other mutations in Plb1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00096:Plb1	APN	5	32345736	missense	probably benign	0.00
IGL00542:Plb1	APN	5	32269834	missense	probably benign	0.02
IGL00835:Plb1	APN	5	32364172	missense	unknown
IGL00954:Plb1	APN	5	32298514	splice site	probably benign
IGL01350:Plb1	APN	5	32317064	missense	probably damaging	1.00
IGL01527:Plb1	APN	5	32317123	missense	probably damaging	1.00
IGL01599:Plb1	APN	5	32342544	splice site	probably benign
IGL01690:Plb1	APN	5	32313697	missense	probably damaging	1.00
IGL01813:Plb1	APN	5	32329085	missense	probably damaging	1.00
IGL01826:Plb1	APN	5	32281145	missense	probably damaging	0.99
IGL02263:Plb1	APN	5	32321348	splice site	probably benign
IGL02314:Plb1	APN	5	32281148	missense	possibly damaging	0.93
IGL02649:Plb1	APN	5	32362568	missense	probably benign	0.09
IGL02701:Plb1	APN	5	32364197	missense	unknown
IGL02704:Plb1	APN	5	32353667	missense	probably benign	0.03
IGL03170:Plb1	APN	5	32284902	missense	probably damaging	0.99
IGL03182:Plb1	APN	5	32344915	splice site	probably benign
IGL03326:Plb1	APN	5	32331327	missense	probably benign	0.00
IGL03046:Plb1	UTSW	5	32328412	missense	probably damaging	1.00
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0013:Plb1	UTSW	5	32349615	splice site	probably benign
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0034:Plb1	UTSW	5	32273113	missense	probably benign	0.16
R0330:Plb1	UTSW	5	32355357	missense	probably damaging	1.00
R0413:Plb1	UTSW	5	32355362	missense	probably damaging	1.00
R0721:Plb1	UTSW	5	32364195	missense	unknown
R0735:Plb1	UTSW	5	32284920	missense	possibly damaging	0.90
R1423:Plb1	UTSW	5	32293257	missense	probably benign
R1428:Plb1	UTSW	5	32264912	missense	possibly damaging	0.82
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1469:Plb1	UTSW	5	32354826	missense	possibly damaging	0.46
R1694:Plb1	UTSW	5	32317277	missense	probably null	0.01
R1801:Plb1	UTSW	5	32293243	missense	probably damaging	1.00
R1804:Plb1	UTSW	5	32353697	missense	possibly damaging	0.91
R1900:Plb1	UTSW	5	32286847	missense	probably benign	0.44
R1903:Plb1	UTSW	5	32291238	missense	probably damaging	1.00
R2101:Plb1	UTSW	5	32349660	missense	probably damaging	1.00
R2153:Plb1	UTSW	5	32314089	missense	probably damaging	1.00
R2207:Plb1	UTSW	5	32316640	missense	possibly damaging	0.50
R2270:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2271:Plb1	UTSW	5	32293242	missense	probably damaging	1.00
R2311:Plb1	UTSW	5	32269818	missense	probably benign	0.01
R2850:Plb1	UTSW	5	32293224	missense	probably benign
R3103:Plb1	UTSW	5	32328029	missense	possibly damaging	0.92
R4444:Plb1	UTSW	5	32330565	missense	probably benign	0.06
R4559:Plb1	UTSW	5	32332831	missense	probably damaging	0.99
R4577:Plb1	UTSW	5	32247557	nonsense	probably null
R4578:Plb1	UTSW	5	32247557	nonsense	probably null
R4739:Plb1	UTSW	5	32349679	splice site	probably null
R4747:Plb1	UTSW	5	32349659	missense	probably benign	0.08
R4806:Plb1	UTSW	5	32289852	missense	probably damaging	1.00
R5567:Plb1	UTSW	5	32364199	missense	unknown
R5574:Plb1	UTSW	5	32329947	missense	probably benign	0.13
R5588:Plb1	UTSW	5	32329949	critical splice donor site	probably null
R5619:Plb1	UTSW	5	32333497	missense	probably damaging	0.99
R5769:Plb1	UTSW	5	32317522	missense	probably benign	0.05
R6366:Plb1	UTSW	5	32314085	missense	possibly damaging	0.59
R6700:Plb1	UTSW	5	32333464	missense	probably damaging	0.99
R7162:Plb1	UTSW	5	32349663	missense	probably benign	0.30
R7379:Plb1	UTSW	5	32345639	missense	probably damaging	1.00
R7395:Plb1	UTSW	5	32353684	missense	probably benign	0.30
R7426:Plb1	UTSW	5	32321247	splice site	probably null
R7643:Plb1	UTSW	5	32247557	nonsense	probably null
R7657:Plb1	UTSW	5	32329867	missense	probably damaging	0.98
R7780:Plb1	UTSW	5	32326266	splice site	probably null
R8040:Plb1	UTSW	5	32273069	missense	possibly damaging	0.89
R8212:Plb1	UTSW	5	32264906	missense	probably damaging	1.00
R8312:Plb1	UTSW	5	32328485	missense	probably damaging	1.00
X0018:Plb1	UTSW	5	32285883	missense	probably benign	0.01
X0019:Plb1	UTSW	5	32353697	missense	probably damaging	0.99
X0027:Plb1	UTSW	5	32270358	missense	probably benign
X0028:Plb1	UTSW	5	32302675	missense	probably damaging	1.00
Z1088:Plb1	UTSW	5	32310917	missense	probably benign
Z1088:Plb1	UTSW	5	32310847	missense	probably damaging	0.99
Z1177:Plb1	UTSW	5	32284897	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- GCTGCTGGCTCCATTCAAAC -3'
(R):5'- CTTGGGACCTCCTAGCATCTAG -3'

Sequencing Primer
(F):5'- GCTGGCTCCATTCAAACATAGATAGG -3'
(R):5'- GCATCTAGCTCTGCCATGCATTG -3'

Posted On

2016-09-01