Incidental Mutation 'R5406:Nfxl1'
ID426272
Institutional Source Beutler Lab
Gene Symbol Nfxl1
Ensembl Gene ENSMUSG00000072889
Gene Namenuclear transcription factor, X-box binding-like 1
Synonyms1700012H24Rik, TCF9, D430033A06Rik, LOC381696
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location72513301-72559684 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 72556198 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 134 (T134I)
Ref Sequence ENSEMBL: ENSMUSP00000074481 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074948] [ENSMUST00000087216] [ENSMUST00000135318]
Predicted Effect possibly damaging
Transcript: ENSMUST00000074948
AA Change: T134I

PolyPhen 2 Score 0.922 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074481
Gene: ENSMUSG00000072889
AA Change: T134I

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000087216
AA Change: T134I

PolyPhen 2 Score 0.514 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084467
Gene: ENSMUSG00000072889
AA Change: T134I

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
ZnF_NFX 378 397 2.88e-4 SMART
ZnF_NFX 431 450 5.01e-4 SMART
ZnF_NFX 458 479 1.67e2 SMART
ZnF_NFX 483 502 9.71e-2 SMART
ZnF_NFX 510 529 3.49e-3 SMART
ZnF_NFX 567 587 4.56e1 SMART
Pfam:zf-NF-X1 596 608 6.8e-3 PFAM
ZnF_NFX 677 710 4.23e1 SMART
ZnF_NFX 720 738 5.49e-1 SMART
ZnF_NFX 782 801 1.63e-3 SMART
coiled coil region 829 880 N/A INTRINSIC
transmembrane domain 897 914 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134452
Predicted Effect probably benign
Transcript: ENSMUST00000135318
AA Change: T134I

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000114355
Gene: ENSMUSG00000072889
AA Change: T134I

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
low complexity region 25 64 N/A INTRINSIC
low complexity region 106 125 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
RING 167 226 4.99e-1 SMART
ZnF_NFX 272 290 2.83e-3 SMART
ZnF_NFX 325 344 1.42e-3 SMART
ZnF_NFX 378 397 2.88e-4 SMART
ZnF_NFX 431 450 5.01e-4 SMART
ZnF_NFX 458 479 1.67e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146761
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198977
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Nfxl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01094:Nfxl1 APN 5 72550428 splice site probably benign
IGL01716:Nfxl1 APN 5 72540934 missense probably damaging 1.00
IGL02592:Nfxl1 APN 5 72514229 missense probably benign 0.25
IGL03083:Nfxl1 APN 5 72540662 splice site probably benign
FR4548:Nfxl1 UTSW 5 72559115 small insertion probably benign
FR4737:Nfxl1 UTSW 5 72559121 small insertion probably benign
R0478:Nfxl1 UTSW 5 72524645 critical splice donor site probably null
R0725:Nfxl1 UTSW 5 72559130 missense probably benign
R1374:Nfxl1 UTSW 5 72524145 missense probably benign 0.04
R1616:Nfxl1 UTSW 5 72529037 missense probably benign 0.01
R1752:Nfxl1 UTSW 5 72540875 missense probably damaging 1.00
R2108:Nfxl1 UTSW 5 72514332 critical splice acceptor site probably null
R3081:Nfxl1 UTSW 5 72529035 missense possibly damaging 0.92
R3693:Nfxl1 UTSW 5 72540611 missense probably damaging 0.99
R3725:Nfxl1 UTSW 5 72517062 missense probably damaging 1.00
R4660:Nfxl1 UTSW 5 72552668 missense probably damaging 1.00
R5058:Nfxl1 UTSW 5 72556239 missense probably benign 0.03
R5447:Nfxl1 UTSW 5 72529169 missense probably benign 0.01
R5634:Nfxl1 UTSW 5 72529490 missense probably damaging 1.00
R5831:Nfxl1 UTSW 5 72522197 missense probably benign
R5910:Nfxl1 UTSW 5 72540365 missense probably benign 0.05
R6086:Nfxl1 UTSW 5 72541019 missense probably benign 0.39
R6091:Nfxl1 UTSW 5 72514190 missense probably benign 0.00
R6212:Nfxl1 UTSW 5 72516210 critical splice donor site probably null
R6501:Nfxl1 UTSW 5 72528509 splice site probably null
R6521:Nfxl1 UTSW 5 72540308 splice site probably null
R7283:Nfxl1 UTSW 5 72529050 missense probably benign
R7426:Nfxl1 UTSW 5 72524174 nonsense probably null
R7480:Nfxl1 UTSW 5 72559252 nonsense probably null
R7648:Nfxl1 UTSW 5 72523536 missense probably benign 0.12
R7817:Nfxl1 UTSW 5 72514289 missense possibly damaging 0.89
R7899:Nfxl1 UTSW 5 72524215 missense probably damaging 1.00
R8186:Nfxl1 UTSW 5 72559012 critical splice donor site probably null
R8468:Nfxl1 UTSW 5 72518205 missense possibly damaging 0.95
Z1176:Nfxl1 UTSW 5 72538150 missense probably null 0.89
Predicted Primers PCR Primer
(F):5'- GGGTTGTAAAAGACACTTGCC -3'
(R):5'- TTGCGAGGACACGGATTTGC -3'

Sequencing Primer
(F):5'- CAGCTTTACAAGATGACCAC -3'
(R):5'- CACGGATTTGCAGAAATGAAACTC -3'
Posted On2016-09-01