Incidental Mutation 'R5406:Gbp4'
ID426274
Institutional Source Beutler Lab
Gene Symbol Gbp4
Ensembl Gene ENSMUSG00000079363
Gene Nameguanylate binding protein 4
SynonymsMpa2, Mag-2, Mpa-2
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location105115767-105139586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 105119521 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 511 (Q511K)
Ref Sequence ENSEMBL: ENSMUSP00000098522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000100961] [ENSMUST00000100962] [ENSMUST00000196204] [ENSMUST00000196677] [ENSMUST00000199629]
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100961
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100962
AA Change: Q511K

PolyPhen 2 Score 0.759 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000098522
Gene: ENSMUSG00000079363
AA Change: Q511K

DomainStartEndE-ValueType
Pfam:GBP 16 287 4.2e-91 PFAM
Pfam:GBP_C 289 583 4.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196204
SMART Domains Protein: ENSMUSP00000142528
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 16 76 1e-19 PFAM
low complexity region 82 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196677
SMART Domains Protein: ENSMUSP00000142795
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 1 149 3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199629
SMART Domains Protein: ENSMUSP00000143689
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 1 127 1.5e-43 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Gbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Gbp4 APN 5 105137021 start codon destroyed probably null 0.00
IGL01834:Gbp4 APN 5 105125602 missense probably damaging 1.00
IGL02100:Gbp4 APN 5 105122075 unclassified probably benign
IGL02119:Gbp4 APN 5 105121042 missense probably benign 0.14
IGL02364:Gbp4 APN 5 105136874 missense probably damaging 1.00
IGL03026:Gbp4 APN 5 105120000 missense possibly damaging 0.88
PIT4651001:Gbp4 UTSW 5 105118423 missense probably benign 0.08
R0147:Gbp4 UTSW 5 105119496 missense probably benign 0.17
R0148:Gbp4 UTSW 5 105119496 missense probably benign 0.17
R0413:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
R0415:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
R0478:Gbp4 UTSW 5 105119433 missense probably benign 0.01
R0546:Gbp4 UTSW 5 105120970 missense probably damaging 1.00
R0638:Gbp4 UTSW 5 105121840 missense probably damaging 0.98
R1528:Gbp4 UTSW 5 105121792 splice site probably null
R1541:Gbp4 UTSW 5 105118409 missense probably benign
R2099:Gbp4 UTSW 5 105121081 missense probably damaging 1.00
R2112:Gbp4 UTSW 5 105135176 missense possibly damaging 0.95
R2994:Gbp4 UTSW 5 105137020 start codon destroyed probably null 0.86
R4021:Gbp4 UTSW 5 105120923 missense probably damaging 0.96
R4258:Gbp4 UTSW 5 105136975 missense probably damaging 1.00
R4489:Gbp4 UTSW 5 105121907 missense probably damaging 1.00
R5164:Gbp4 UTSW 5 105136877 nonsense probably null
R5195:Gbp4 UTSW 5 105119532 missense probably benign 0.00
R5550:Gbp4 UTSW 5 105122045 missense probably damaging 1.00
R5701:Gbp4 UTSW 5 105118399 missense possibly damaging 0.60
R5814:Gbp4 UTSW 5 105119919 missense probably benign 0.27
R6128:Gbp4 UTSW 5 105135164 missense possibly damaging 0.93
R6307:Gbp4 UTSW 5 105123109 nonsense probably null
R6513:Gbp4 UTSW 5 105123120 missense possibly damaging 0.69
R6870:Gbp4 UTSW 5 105125578 missense probably damaging 1.00
R6938:Gbp4 UTSW 5 105135077 missense probably damaging 0.99
R7063:Gbp4 UTSW 5 105118448 missense probably damaging 0.96
R7124:Gbp4 UTSW 5 105119959 missense possibly damaging 0.45
R7457:Gbp4 UTSW 5 105119553 missense probably damaging 0.98
R7615:Gbp4 UTSW 5 105122982 missense possibly damaging 0.95
R7877:Gbp4 UTSW 5 105118295 missense probably benign 0.34
R7905:Gbp4 UTSW 5 105121087 missense probably damaging 1.00
R8274:Gbp4 UTSW 5 105119472 missense probably benign 0.01
R8377:Gbp4 UTSW 5 105118462 missense probably benign 0.02
R8414:Gbp4 UTSW 5 105136837 missense probably benign 0.05
R8423:Gbp4 UTSW 5 105119934 missense probably damaging 1.00
S24628:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
X0067:Gbp4 UTSW 5 105125625 missense probably damaging 0.98
Z1088:Gbp4 UTSW 5 105120997 missense probably damaging 1.00
Z1177:Gbp4 UTSW 5 105119449 nonsense probably null
Z1177:Gbp4 UTSW 5 105125135 missense probably null 0.89
Predicted Primers PCR Primer
(F):5'- CCTGGAGAATGAGAACCACC -3'
(R):5'- ACATGGGCATGGTCTTCTCC -3'

Sequencing Primer
(F):5'- ACCAGGAGGATCAGTAGCCC -3'
(R):5'- GAAACATGCTCCCCAAGTGTGG -3'
Posted On2016-09-01