Incidental Mutation 'R5406:Adam26a'
ID426278
Institutional Source Beutler Lab
Gene Symbol Adam26a
Ensembl Gene ENSMUSG00000048516
Gene Namea disintegrin and metallopeptidase domain 26A (testase 3)
SynonymsDtgn4, Adam26
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location43568278-43576707 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43569104 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 450 (C450S)
Ref Sequence ENSEMBL: ENSMUSP00000058256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049577]
Predicted Effect probably damaging
Transcript: ENSMUST00000049577
AA Change: C450S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058256
Gene: ENSMUSG00000048516
AA Change: C450S

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 29 147 2.1e-18 PFAM
Pfam:Reprolysin_5 193 364 4.8e-15 PFAM
Pfam:Reprolysin_4 194 380 2.2e-9 PFAM
Pfam:Reprolysin 195 385 2.7e-48 PFAM
Pfam:Reprolysin_2 215 377 2.4e-16 PFAM
Pfam:Reprolysin_3 219 340 1.2e-15 PFAM
DISIN 401 476 2.98e-41 SMART
ACR 477 613 2.06e-64 SMART
transmembrane domain 671 693 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during the late stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. This gene is located adjacent to two other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Adam26a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Adam26a APN 8 43568859 missense possibly damaging 0.75
IGL00519:Adam26a APN 8 43569525 missense probably damaging 1.00
IGL00658:Adam26a APN 8 43568903 missense probably benign 0.00
IGL01514:Adam26a APN 8 43568448 missense probably benign
IGL01988:Adam26a APN 8 43569170 missense possibly damaging 0.68
IGL02030:Adam26a APN 8 43568857 missense probably benign 0.00
IGL02081:Adam26a APN 8 43570196 missense probably damaging 0.99
IGL02444:Adam26a APN 8 43569673 missense possibly damaging 0.46
IGL02734:Adam26a APN 8 43569775 missense probably benign 0.27
IGL03243:Adam26a APN 8 43568696 missense probably benign 0.14
IGL03350:Adam26a APN 8 43569552 nonsense probably null
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0206:Adam26a UTSW 8 43570418 missense possibly damaging 0.81
R0324:Adam26a UTSW 8 43568453 missense probably benign
R0830:Adam26a UTSW 8 43568402 missense probably benign 0.23
R0960:Adam26a UTSW 8 43568763 missense probably damaging 1.00
R1259:Adam26a UTSW 8 43568647 missense probably benign 0.20
R1259:Adam26a UTSW 8 43568713 missense possibly damaging 0.95
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1403:Adam26a UTSW 8 43569192 nonsense probably null
R1719:Adam26a UTSW 8 43570036 missense possibly damaging 0.93
R1750:Adam26a UTSW 8 43570189 missense possibly damaging 0.90
R1860:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1861:Adam26a UTSW 8 43569541 missense possibly damaging 0.66
R1875:Adam26a UTSW 8 43569851 missense probably benign 0.37
R3959:Adam26a UTSW 8 43569871 missense probably benign 0.00
R4355:Adam26a UTSW 8 43570185 missense probably benign 0.35
R4604:Adam26a UTSW 8 43570051 missense probably benign 0.02
R4612:Adam26a UTSW 8 43568793 missense probably damaging 0.99
R4909:Adam26a UTSW 8 43570438 missense probably benign 0.08
R4937:Adam26a UTSW 8 43568881 missense probably damaging 1.00
R5112:Adam26a UTSW 8 43568856 missense probably benign 0.04
R5276:Adam26a UTSW 8 43570420 missense probably benign 0.30
R5501:Adam26a UTSW 8 43569904 nonsense probably null
R5955:Adam26a UTSW 8 43569852 missense probably benign 0.11
R6262:Adam26a UTSW 8 43569088 missense possibly damaging 0.91
R6847:Adam26a UTSW 8 43568428 missense probably benign 0.23
R6957:Adam26a UTSW 8 43568903 missense probably benign 0.00
R7053:Adam26a UTSW 8 43568799 nonsense probably null
R7287:Adam26a UTSW 8 43570343 missense possibly damaging 0.95
R7393:Adam26a UTSW 8 43569688 missense probably benign 0.01
R7477:Adam26a UTSW 8 43569070 missense probably damaging 1.00
R7552:Adam26a UTSW 8 43569970 missense possibly damaging 0.77
R7670:Adam26a UTSW 8 43570153 missense probably benign 0.13
R7918:Adam26a UTSW 8 43569529 missense probably damaging 0.98
R8193:Adam26a UTSW 8 43569236 missense probably damaging 1.00
R8262:Adam26a UTSW 8 43569141 nonsense probably null
Z1088:Adam26a UTSW 8 43569698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCACAGTTCCCAAAGCG -3'
(R):5'- CTGACCGTGTGTGGGAATAAG -3'

Sequencing Primer
(F):5'- AAAGCGGTCACCCTGTCTG -3'
(R):5'- TGTGGGAATAAGGTGGTTGAAG -3'
Posted On2016-09-01