Mutagenetix > Incidental Mutations

Incidental Mutation 'R5406:Cntn5'

426282

Institutional Source

Beutler Lab

Gene Symbol

Cntn5

Ensembl Gene

ENSMUSG00000039488

Gene Name

contactin 5

Synonyms

NB-2, LOC244683, 6720426O10Rik, A830025P08Rik

MMRRC Submission

042976-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

9660891-10904775 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 9833460 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 362 (V362D)

Ref Sequence

ENSEMBL: ENSMUSP00000135903 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074133] [ENSMUST00000160216] [ENSMUST00000162484] [ENSMUST00000179049]

Predicted Effect

probably damaging
Transcript: ENSMUST00000074133
AA Change: V567D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000073769
Gene: ENSMUSG00000039488
AA Change: V567D

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IGc2	113	179	1.11e-10	SMART
IG	201	289	4.82e-6	SMART
IGc2	312	375	1.4e-16	SMART
IGc2	401	464	8.97e-15	SMART
IGc2	493	557	4.96e-8	SMART
IG	577	667	2.13e-7	SMART
FN3	670	756	1.01e-11	SMART
FN3	773	859	9.19e-1	SMART
FN3	875	958	3.99e-10	SMART
FN3	974	1053	1.68e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000160216
AA Change: V567D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124327
Gene: ENSMUSG00000039488
AA Change: V567D

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
IGc2	113	179	1.11e-10	SMART
IG	201	289	4.82e-6	SMART
IGc2	312	375	1.4e-16	SMART
IGc2	401	464	8.97e-15	SMART
IGc2	493	557	4.96e-8	SMART
IG	577	667	2.13e-7	SMART
FN3	670	756	1.01e-11	SMART
FN3	773	859	9.19e-1	SMART
FN3	875	958	3.99e-10	SMART
FN3	974	1053	1.68e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000162484
AA Change: V362D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000124214
Gene: ENSMUSG00000039488
AA Change: V362D

Domain	Start	End	E-Value	Type
IG_like	10	84	1.12e2	SMART
IGc2	107	170	1.4e-16	SMART
IGc2	196	259	8.97e-15	SMART
IGc2	288	352	4.96e-8	SMART
IG	372	462	2.13e-7	SMART
FN3	465	551	1.01e-11	SMART
FN3	568	654	9.19e-1	SMART
FN3	670	753	3.99e-10	SMART
FN3	769	848	1.68e-3	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000179049
AA Change: V362D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135903
Gene: ENSMUSG00000039488
AA Change: V362D

Domain	Start	End	E-Value	Type
IG_like	10	84	1.12e2	SMART
IGc2	107	170	1.4e-16	SMART
IGc2	196	259	8.97e-15	SMART
IGc2	288	352	4.96e-8	SMART
IG	372	462	2.13e-7	SMART
FN3	465	551	1.01e-11	SMART
FN3	568	654	9.19e-1	SMART
FN3	670	753	3.99e-10	SMART
FN3	769	848	1.68e-3	SMART

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin superfamily, and contactin family, which mediate cell surface interactions during nervous system development. This protein is a glycosylphosphatidylinositol (GPI)-anchored neuronal membrane protein that functions as a cell adhesion molecule. It may play a role in the formation of axon connections in the developing nervous system. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice are viable, fertile, and less susceptible to audiogenic seizures. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,387	V17D	probably damaging	Het
Abcb1a	C	A	5: 8,702,946	Q566K	probably damaging	Het
Adam26a	A	T	8: 43,569,104	C450S	probably damaging	Het
Adar	C	T	3: 89,736,111	P433L	probably damaging	Het
Aldh1a2	G	T	9: 71,255,121	A151S	possibly damaging	Het
Arsk	T	A	13: 76,093,947	H69L	probably benign	Het
Atf6b	T	A	17: 34,653,797	Y600*	probably null	Het
Blk	C	A	14: 63,380,731	G242V	probably damaging	Het
Bmt2	A	T	6: 13,677,832	M1K	probably null	Het
Catsperg1	G	A	7: 29,185,523	T891M	probably damaging	Het
Ccdc32	A	C	2: 119,022,079	S131A	possibly damaging	Het
Cdh8	A	G	8: 99,196,370	V298A	probably damaging	Het
Cfap54	T	A	10: 93,001,858	Q1060L	probably benign	Het
Cfap58	G	A	19: 48,029,102	M800I	possibly damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
G2e3	T	C	12: 51,372,666	S699P	probably damaging	Het
Gbp4	G	T	5: 105,119,521	Q511K	possibly damaging	Het
Gdap2	T	A	3: 100,191,675	I361N	probably damaging	Het
Ino80c	T	A	18: 24,112,762	H92L	probably benign	Het
Lipo4	A	G	19: 33,503,218	V250A	probably benign	Het
Llgl1	C	T	11: 60,713,184	R1055W	probably damaging	Het
Lrriq3	T	C	3: 155,129,501		probably null	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Ncstn	A	G	1: 172,072,164	V317A	probably benign	Het
Nfxl1	G	A	5: 72,556,198	T134I	possibly damaging	Het
Nup155	A	T	15: 8,153,638		probably null	Het
Nup214	C	A	2: 32,002,607	P680T	probably damaging	Het
Olfr805	G	A	10: 129,722,930	L205F	probably damaging	Het
Olfr871	A	G	9: 20,213,158	K270E	probably benign	Het
Olfr874	A	G	9: 37,746,647	N171S	probably benign	Het
Olfr877	G	A	9: 37,855,219	V134I	probably benign	Het
Pkd2	T	C	5: 104,480,332	F424S	probably damaging	Het
Plb1	A	G	5: 32,341,915	D1074G	probably damaging	Het
Ppm1l	T	C	3: 69,317,594	S10P	possibly damaging	Het
Rnf213	A	G	11: 119,440,808	H2281R	probably damaging	Het
Rpa2	G	T	4: 132,776,248	A3S	probably benign	Het
Sardh	A	G	2: 27,211,084	V698A	possibly damaging	Het
Saxo2	A	T	7: 82,635,378	C91S	probably benign	Het
Slc3a2	T	C	19: 8,708,042	D198G	probably damaging	Het
Spata31d1d	T	A	13: 59,728,778	E314D	probably benign	Het
Sptlc3	T	C	2: 139,546,478	V130A	probably benign	Het
Stpg3	C	A	2: 25,213,568	E115*	probably null	Het
Tbcd	T	A	11: 121,452,101	D19E	probably benign	Het
Xrcc3	T	C	12: 111,812,111	D2G	probably damaging	Het

Other mutations in Cntn5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00742:Cntn5	APN	9	9976297	missense	probably damaging	0.99
IGL01118:Cntn5	APN	9	9831560	missense	possibly damaging	0.94
IGL01328:Cntn5	APN	9	9781768	missense	probably damaging	1.00
IGL01445:Cntn5	APN	9	9693484	splice site	probably benign
IGL01505:Cntn5	APN	9	9706087	missense	probably damaging	1.00
IGL01556:Cntn5	APN	9	9673908	missense	probably benign
IGL01804:Cntn5	APN	9	9831537	missense	probably damaging	0.99
IGL02173:Cntn5	APN	9	9748396	missense	probably damaging	1.00
IGL02250:Cntn5	APN	9	10145331	missense	probably damaging	1.00
IGL02366:Cntn5	APN	9	9984055	splice site	probably benign
IGL02565:Cntn5	APN	9	10145338	nonsense	probably null
IGL02593:Cntn5	APN	9	9833499	missense	probably damaging	1.00
IGL02743:Cntn5	APN	9	9984110	missense	probably damaging	1.00
IGL02976:Cntn5	APN	9	10419099	unclassified	probably benign
IGL03103:Cntn5	APN	9	9972812	splice site	probably benign
IGL03114:Cntn5	APN	9	9748452	missense	probably damaging	1.00
IGL03156:Cntn5	APN	9	9673877	missense	probably damaging	1.00
IGL02802:Cntn5	UTSW	9	10048678	splice site	probably null
R0243:Cntn5	UTSW	9	9781775	missense	probably damaging	1.00
R0385:Cntn5	UTSW	9	9972870	missense	probably damaging	1.00
R0541:Cntn5	UTSW	9	9673402	splice site	probably benign
R0827:Cntn5	UTSW	9	9666938	missense	possibly damaging	0.88
R1029:Cntn5	UTSW	9	9831572	missense	probably damaging	1.00
R1440:Cntn5	UTSW	9	10145339	missense	probably damaging	1.00
R1463:Cntn5	UTSW	9	9673796	critical splice donor site	probably null
R1536:Cntn5	UTSW	9	9976316	missense	possibly damaging	0.78
R1746:Cntn5	UTSW	9	9831572	missense	probably damaging	1.00
R1761:Cntn5	UTSW	9	10172054	missense	probably benign	0.01
R1764:Cntn5	UTSW	9	9673983	missense	probably benign
R1859:Cntn5	UTSW	9	9972834	missense	probably damaging	1.00
R1888:Cntn5	UTSW	9	9984077	missense	possibly damaging	0.95
R1888:Cntn5	UTSW	9	9984077	missense	possibly damaging	0.95
R1950:Cntn5	UTSW	9	9781769	missense	probably damaging	1.00
R2143:Cntn5	UTSW	9	9748415	missense	probably damaging	0.98
R2145:Cntn5	UTSW	9	9748415	missense	probably damaging	0.98
R2437:Cntn5	UTSW	9	10048753	nonsense	probably null
R2440:Cntn5	UTSW	9	10171955	missense	possibly damaging	0.91
R2504:Cntn5	UTSW	9	10172121	missense	probably benign
R3054:Cntn5	UTSW	9	10419071	missense	probably benign	0.30
R3056:Cntn5	UTSW	9	10419071	missense	probably benign	0.30
R3804:Cntn5	UTSW	9	9781663	splice site	probably benign
R4164:Cntn5	UTSW	9	9781676	missense	probably damaging	1.00
R4444:Cntn5	UTSW	9	9704942	missense	probably damaging	1.00
R4472:Cntn5	UTSW	9	10048771	missense	probably damaging	1.00
R4576:Cntn5	UTSW	9	9673292	missense	probably benign	0.10
R4624:Cntn5	UTSW	9	9704804	nonsense	probably null
R4652:Cntn5	UTSW	9	9704912	missense	possibly damaging	0.68
R4664:Cntn5	UTSW	9	10144209	missense	possibly damaging	0.71
R4679:Cntn5	UTSW	9	9970531	missense	probably benign	0.09
R4829:Cntn5	UTSW	9	9976283	missense	probably damaging	1.00
R4929:Cntn5	UTSW	9	9976395	critical splice acceptor site	probably null
R5211:Cntn5	UTSW	9	9704889	missense	possibly damaging	0.88
R5468:Cntn5	UTSW	9	9743628	missense	probably damaging	1.00
R5584:Cntn5	UTSW	9	9661452	missense	possibly damaging	0.91
R5688:Cntn5	UTSW	9	9748422	missense	probably damaging	1.00
R5762:Cntn5	UTSW	9	9748389	missense	possibly damaging	0.95
R6141:Cntn5	UTSW	9	10144157	missense	probably benign
R6147:Cntn5	UTSW	9	10012889	missense	probably damaging	0.98
R6325:Cntn5	UTSW	9	10144323	splice site	probably null
R6377:Cntn5	UTSW	9	9743652	missense	probably damaging	1.00
R6774:Cntn5	UTSW	9	10144217	missense	probably damaging	1.00
R7117:Cntn5	UTSW	9	10904699	start gained	probably benign
R7252:Cntn5	UTSW	9	9831635	missense	probably benign	0.00
R7363:Cntn5	UTSW	9	10172016	missense	probably benign	0.00
R7401:Cntn5	UTSW	9	9833461	missense	probably benign	0.13
R7488:Cntn5	UTSW	9	9970565	missense	probably damaging	0.99
R7548:Cntn5	UTSW	9	9673410	splice site	probably null
R7662:Cntn5	UTSW	9	9661385	missense	probably benign	0.17
R7718:Cntn5	UTSW	9	9984128	missense	probably benign
R7719:Cntn5	UTSW	9	9704898	missense	probably damaging	1.00
R7788:Cntn5	UTSW	9	9704929	missense	probably benign	0.01
R7864:Cntn5	UTSW	9	9984177	missense	probably damaging	0.98
R7937:Cntn5	UTSW	9	9748445	missense	probably damaging	1.00
R8117:Cntn5	UTSW	9	9673950	missense	probably benign	0.33
R8159:Cntn5	UTSW	9	10145381	missense	possibly damaging	0.91
R8349:Cntn5	UTSW	9	9666835	critical splice donor site	probably null
R8449:Cntn5	UTSW	9	9666835	critical splice donor site	probably null
Z1177:Cntn5	UTSW	9	9673962	nonsense	probably null
Z1177:Cntn5	UTSW	9	10090236	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAGCCATTGTTCCCATTTCTG -3'
(R):5'- CGTCAGAAGTTCTTGCCATTTAG -3'

Sequencing Primer
(F):5'- TCTGTTTCCAGTCTTTAAATGATGG -3'
(R):5'- GTTGCTTTGAATTGAAATGGGAAC -3'

Posted On

2016-09-01