Incidental Mutation 'R5406:Olfr871'
ID426283
Institutional Source Beutler Lab
Gene Symbol Olfr871
Ensembl Gene ENSMUSG00000061457
Gene Nameolfactory receptor 871
SynonymsGA_x6K02T2PVTD-13952555-13953490, MOR141-2
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location20212207-20213353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20213158 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 270 (K270E)
Ref Sequence ENSEMBL: ENSMUSP00000072865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073122]
Predicted Effect probably benign
Transcript: ENSMUST00000073122
AA Change: K270E

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000072865
Gene: ENSMUSG00000061457
AA Change: K270E

DomainStartEndE-ValueType
Pfam:7tm_4 31 311 8.3e-52 PFAM
Pfam:7TM_GPCR_Srsx 35 304 2.1e-7 PFAM
Pfam:7tm_1 41 290 9.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158891
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Olfr871
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01977:Olfr871 APN 9 20212459 missense possibly damaging 0.89
IGL02291:Olfr871 APN 9 20212802 missense probably benign 0.00
IGL02312:Olfr871 APN 9 20213081 missense probably damaging 1.00
IGL02345:Olfr871 APN 9 20213018 missense possibly damaging 0.88
R0278:Olfr871 UTSW 9 20212886 missense probably damaging 1.00
R0520:Olfr871 UTSW 9 20212495 missense probably benign 0.01
R1606:Olfr871 UTSW 9 20212946 missense probably benign 0.05
R3751:Olfr871 UTSW 9 20213260 missense probably damaging 0.98
R4701:Olfr871 UTSW 9 20212625 missense probably damaging 1.00
R4811:Olfr871 UTSW 9 20212753 missense probably damaging 1.00
R5074:Olfr871 UTSW 9 20212582 missense possibly damaging 0.63
R6541:Olfr871 UTSW 9 20212399 missense probably benign 0.01
R6730:Olfr871 UTSW 9 20212502 missense probably benign 0.04
R7195:Olfr871 UTSW 9 20212544 missense probably damaging 0.99
R7197:Olfr871 UTSW 9 20212555 missense probably benign 0.00
R7384:Olfr871 UTSW 9 20212745 missense probably damaging 1.00
R7715:Olfr871 UTSW 9 20212435 missense probably damaging 0.97
R7715:Olfr871 UTSW 9 20212436 missense probably benign 0.06
R8108:Olfr871 UTSW 9 20212451 missense possibly damaging 0.62
R8409:Olfr871 UTSW 9 20212246 start gained probably benign
RF013:Olfr871 UTSW 9 20212894 missense probably benign 0.00
Z1176:Olfr871 UTSW 9 20212844 missense possibly damaging 0.94
Z1177:Olfr871 UTSW 9 20213186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACTATAGCCTGCTCAGAC -3'
(R):5'- GGACAGAATTTCTTTATCCTACTGC -3'

Sequencing Primer
(F):5'- TATAGCCTGCTCAGACACACTAATC -3'
(R):5'- ACTGCTTTACTTTTGTAACCTCAG -3'
Posted On2016-09-01