Mutagenetix > Incidental Mutations

Incidental Mutation 'R5406:Olfr805'

426288

Institutional Source

Beutler Lab

Gene Symbol

Olfr805

Ensembl Gene

ENSMUSG00000096858

Gene Name

olfactory receptor 805

Synonyms

GA_x6K02T2PULF-11402237-11401278, MOR110-4

MMRRC Submission

042976-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.101) question?

Stock #

R5406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

129721221-129729375 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 129722930 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 205 (L205F)

Ref Sequence

ENSEMBL: ENSMUSP00000149493 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078876] [ENSMUST00000204717] [ENSMUST00000216794] [ENSMUST00000217219]

Predicted Effect

probably damaging
Transcript: ENSMUST00000078876
AA Change: L205F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000092874
Gene: ENSMUSG00000096858
AA Change: L205F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	28	306	3.9e-52	PFAM
Pfam:7tm_1	39	288	5.1e-23	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203573
AA Change: L205F

SMART Domains

Protein: ENSMUSP00000144843
Gene: ENSMUSG00000096858
AA Change: L205F

Domain	Start	End	E-Value	Type
Pfam:7tm_4	28	306	3.9e-52	PFAM
Pfam:7tm_1	39	288	5.1e-23	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000204717

Predicted Effect

probably damaging
Transcript: ENSMUST00000216794
AA Change: L205F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Predicted Effect

probably damaging
Transcript: ENSMUST00000217219
AA Change: L205F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,387	V17D	probably damaging	Het
Abcb1a	C	A	5: 8,702,946	Q566K	probably damaging	Het
Adam26a	A	T	8: 43,569,104	C450S	probably damaging	Het
Adar	C	T	3: 89,736,111	P433L	probably damaging	Het
Aldh1a2	G	T	9: 71,255,121	A151S	possibly damaging	Het
Arsk	T	A	13: 76,093,947	H69L	probably benign	Het
Atf6b	T	A	17: 34,653,797	Y600*	probably null	Het
Blk	C	A	14: 63,380,731	G242V	probably damaging	Het
Bmt2	A	T	6: 13,677,832	M1K	probably null	Het
Catsperg1	G	A	7: 29,185,523	T891M	probably damaging	Het
Ccdc32	A	C	2: 119,022,079	S131A	possibly damaging	Het
Cdh8	A	G	8: 99,196,370	V298A	probably damaging	Het
Cfap54	T	A	10: 93,001,858	Q1060L	probably benign	Het
Cfap58	G	A	19: 48,029,102	M800I	possibly damaging	Het
Cntn5	A	T	9: 9,833,460	V362D	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
G2e3	T	C	12: 51,372,666	S699P	probably damaging	Het
Gbp4	G	T	5: 105,119,521	Q511K	possibly damaging	Het
Gdap2	T	A	3: 100,191,675	I361N	probably damaging	Het
Ino80c	T	A	18: 24,112,762	H92L	probably benign	Het
Lipo4	A	G	19: 33,503,218	V250A	probably benign	Het
Llgl1	C	T	11: 60,713,184	R1055W	probably damaging	Het
Lrriq3	T	C	3: 155,129,501		probably null	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Ncstn	A	G	1: 172,072,164	V317A	probably benign	Het
Nfxl1	G	A	5: 72,556,198	T134I	possibly damaging	Het
Nup155	A	T	15: 8,153,638		probably null	Het
Nup214	C	A	2: 32,002,607	P680T	probably damaging	Het
Olfr871	A	G	9: 20,213,158	K270E	probably benign	Het
Olfr874	A	G	9: 37,746,647	N171S	probably benign	Het
Olfr877	G	A	9: 37,855,219	V134I	probably benign	Het
Pkd2	T	C	5: 104,480,332	F424S	probably damaging	Het
Plb1	A	G	5: 32,341,915	D1074G	probably damaging	Het
Ppm1l	T	C	3: 69,317,594	S10P	possibly damaging	Het
Rnf213	A	G	11: 119,440,808	H2281R	probably damaging	Het
Rpa2	G	T	4: 132,776,248	A3S	probably benign	Het
Sardh	A	G	2: 27,211,084	V698A	possibly damaging	Het
Saxo2	A	T	7: 82,635,378	C91S	probably benign	Het
Slc3a2	T	C	19: 8,708,042	D198G	probably damaging	Het
Spata31d1d	T	A	13: 59,728,778	E314D	probably benign	Het
Sptlc3	T	C	2: 139,546,478	V130A	probably benign	Het
Stpg3	C	A	2: 25,213,568	E115*	probably null	Het
Tbcd	T	A	11: 121,452,101	D19E	probably benign	Het
Xrcc3	T	C	12: 111,812,111	D2G	probably damaging	Het

Other mutations in Olfr805

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01141:Olfr805	APN	10	129722945	missense	probably benign
IGL01341:Olfr805	APN	10	129722878	missense	possibly damaging	0.87
IGL01960:Olfr805	APN	10	129722887	missense	probably damaging	1.00
IGL02729:Olfr805	APN	10	129723521	missense	probably benign	0.01
IGL02969:Olfr805	APN	10	129723196	missense	probably damaging	0.99
R0116:Olfr805	UTSW	10	129722977	missense	probably damaging	1.00
R1236:Olfr805	UTSW	10	129722806	missense	probably damaging	0.98
R1332:Olfr805	UTSW	10	129723247	missense	probably damaging	1.00
R2428:Olfr805	UTSW	10	129722783	missense	probably benign	0.05
R3725:Olfr805	UTSW	10	129723115	missense	probably damaging	1.00
R3726:Olfr805	UTSW	10	129723115	missense	probably damaging	1.00
R3804:Olfr805	UTSW	10	129723049	missense	possibly damaging	0.93
R4365:Olfr805	UTSW	10	129723412	missense	probably damaging	0.99
R4630:Olfr805	UTSW	10	129723481	missense	probably damaging	1.00
R4735:Olfr805	UTSW	10	129722923	missense	probably benign	0.06
R4923:Olfr805	UTSW	10	129722812	missense	probably benign	0.03
R4962:Olfr805	UTSW	10	129722723	missense	probably damaging	1.00
R5324:Olfr805	UTSW	10	129722945	missense	probably benign
R7705:Olfr805	UTSW	10	129723149	missense	probably benign	0.01
R8464:Olfr805	UTSW	10	129722914	missense	possibly damaging	0.88

Predicted Primers

PCR Primer
(F):5'- GTGTTGAGCACAGCTACACC -3'
(R):5'- AGTGTGCCACCTACTTGTCC -3'

Sequencing Primer
(F):5'- GAGCACAGCTACACCTTTATTTAAGC -3'
(R):5'- TCAGCTCCTGGGTGACAG -3'

Posted On

2016-09-01