Incidental Mutation 'R5406:G2e3'
ID426293
Institutional Source Beutler Lab
Gene Symbol G2e3
Ensembl Gene ENSMUSG00000035293
Gene NameG2/M-phase specific E3 ubiquitin ligase
Synonyms6030408C04Rik, D930034K21Rik
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.682) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location51348061-51376986 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 51372666 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 699 (S699P)
Ref Sequence ENSEMBL: ENSMUSP00000054474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021335] [ENSMUST00000054308] [ENSMUST00000119211] [ENSMUST00000121521] [ENSMUST00000219434]
Predicted Effect probably benign
Transcript: ENSMUST00000021335
SMART Domains Protein: ENSMUSP00000021335
Gene: ENSMUSG00000020952

DomainStartEndE-ValueType
Pfam:Sec1 41 632 1.6e-109 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000054308
AA Change: S699P

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000054474
Gene: ENSMUSG00000035293
AA Change: S699P

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 1e-2 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 402 692 2.7e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000119211
AA Change: S722P

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000113270
Gene: ENSMUSG00000035293
AA Change: S722P

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 9e-3 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 383 717 3.1e-13 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000121521
AA Change: S605P
SMART Domains Protein: ENSMUSP00000113191
Gene: ENSMUSG00000035293
AA Change: S605P

DomainStartEndE-ValueType
SCOP:d1bqk__ 2 74 9e-3 SMART
PHD 80 128 5.2e-3 SMART
RING 81 115 5.28e0 SMART
PHD 143 193 3.13e0 SMART
RING 144 192 4.48e-1 SMART
PHD 237 286 1.18e1 SMART
Pfam:HECT 298 598 4e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152236
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218131
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219264
Predicted Effect probably benign
Transcript: ENSMUST00000219434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219799
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele that inactivates this gene die prior to implantation due to massive apoptosis which results in involution of the blastocyst. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in G2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:G2e3 APN 12 51353798 critical splice acceptor site probably null
IGL00793:G2e3 APN 12 51367762 missense probably benign 0.00
IGL02222:G2e3 APN 12 51363233 missense probably damaging 1.00
IGL02335:G2e3 APN 12 51369158 missense probably benign 0.19
IGL03134:G2e3 APN 12 51364030 intron probably benign
Amadeus UTSW 12 51353789 splice site probably null
R1868:G2e3 UTSW 12 51353629 missense probably benign 0.44
R2060:G2e3 UTSW 12 51372606 missense probably damaging 1.00
R3814:G2e3 UTSW 12 51353661 missense probably benign 0.28
R4355:G2e3 UTSW 12 51365337 missense probably benign 0.00
R4360:G2e3 UTSW 12 51363414 splice site probably benign
R4903:G2e3 UTSW 12 51371630 missense probably benign 0.23
R4966:G2e3 UTSW 12 51371630 missense probably benign 0.23
R4974:G2e3 UTSW 12 51369139 missense probably benign 0.00
R5399:G2e3 UTSW 12 51357194 critical splice donor site probably null
R5739:G2e3 UTSW 12 51372504 missense possibly damaging 0.94
R6225:G2e3 UTSW 12 51369136 missense possibly damaging 0.77
R6625:G2e3 UTSW 12 51353789 splice site probably null
R7458:G2e3 UTSW 12 51365507 missense possibly damaging 0.67
R7529:G2e3 UTSW 12 51371604 missense probably damaging 1.00
R7713:G2e3 UTSW 12 51369056 missense probably damaging 0.99
R7748:G2e3 UTSW 12 51371667 missense probably benign 0.00
R7998:G2e3 UTSW 12 51353841 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CTGCAACAACGATGGAAGATATTC -3'
(R):5'- AGTGGTTCGGAAGCCAAACC -3'

Sequencing Primer
(F):5'- GTAGTTCTGTCCCACCAACTGG -3'
(R):5'- GGAAGCCAAACCATCCCTTTATGAG -3'
Posted On2016-09-01