Incidental Mutation 'R5406:Xrcc3'
ID426294
Institutional Source Beutler Lab
Gene Symbol Xrcc3
Ensembl Gene ENSMUSG00000021287
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 3
Synonyms
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location111803192-111813873 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111812111 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 2 (D2G)
Ref Sequence ENSEMBL: ENSMUSP00000118040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021714] [ENSMUST00000021715] [ENSMUST00000127281] [ENSMUST00000134578] [ENSMUST00000220616] [ENSMUST00000221375] [ENSMUST00000222843]
Predicted Effect probably benign
Transcript: ENSMUST00000021714
SMART Domains Protein: ENSMUSP00000021714
Gene: ENSMUSG00000021286

DomainStartEndE-ValueType
FYVE 36 105 7.11e-16 SMART
Pfam:ZFYVE21_C 108 233 1.1e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000021715
AA Change: D2G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021715
Gene: ENSMUSG00000021287
AA Change: D2G

DomainStartEndE-ValueType
Pfam:Rad51 64 343 1.2e-25 PFAM
Pfam:AAA_25 70 261 2e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124064
Predicted Effect probably damaging
Transcript: ENSMUST00000127281
AA Change: D2G

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118040
Gene: ENSMUSG00000021287
AA Change: D2G

DomainStartEndE-ValueType
Pfam:Rad51 64 193 4e-17 PFAM
Pfam:AAA_25 70 192 2.1e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132177
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133679
Predicted Effect probably benign
Transcript: ENSMUST00000134578
SMART Domains Protein: ENSMUSP00000120491
Gene: ENSMUSG00000021288

DomainStartEndE-ValueType
Pfam:TPR_1 1 25 1.9e-4 PFAM
Pfam:TPR_7 1 36 1.9e-4 PFAM
Pfam:TPR_10 75 112 7.8e-9 PFAM
Pfam:TPR_1 77 98 1.4e-4 PFAM
Pfam:TPR_7 78 129 1.7e-5 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145109
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146491
Predicted Effect probably benign
Transcript: ENSMUST00000220616
Predicted Effect probably benign
Transcript: ENSMUST00000221375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221488
Predicted Effect probably benign
Transcript: ENSMUST00000222843
Predicted Effect probably benign
Transcript: ENSMUST00000223211
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. Allelic variants in the human gene are associated with susceptibility to breast cancer and cutaneous malignant melanoma. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Other mutations in Xrcc3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0396:Xrcc3 UTSW 12 111809957 missense probably benign 0.00
R4534:Xrcc3 UTSW 12 111804532 missense probably damaging 0.99
R4535:Xrcc3 UTSW 12 111804532 missense probably damaging 0.99
R5762:Xrcc3 UTSW 12 111804610 missense probably damaging 0.97
R5842:Xrcc3 UTSW 12 111804530 missense possibly damaging 0.94
R5937:Xrcc3 UTSW 12 111807972 missense probably null 0.51
R6985:Xrcc3 UTSW 12 111812096 missense probably damaging 0.98
R7011:Xrcc3 UTSW 12 111804535 missense probably damaging 1.00
R7560:Xrcc3 UTSW 12 111807902 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AACTCAGGTGCCAAAGGTGC -3'
(R):5'- ATCCTTAGCTCTCATGGACCG -3'

Sequencing Primer
(F):5'- TGCCCCTTGCGAGACCAAC -3'
(R):5'- TAGCTCTCATGGACCGGGAGAC -3'
Posted On2016-09-01