Mutagenetix > Incidental Mutations

Incidental Mutation 'R5406:Fkbpl'

426298

Institutional Source

Beutler Lab

Gene Symbol

Fkbpl

Ensembl Gene

ENSMUSG00000033739

Gene Name

FK506 binding protein-like

Synonyms

WAF-1/CIP1 stabilizing protein 39, NG7, DIR1, Ppiase-X, WISp39

MMRRC Submission

042976-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.919) question?

Stock #

R5406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34644764-34646324 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 34645329 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 24 (A24T)

Ref Sequence

ENSEMBL: ENSMUSP00000037273 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000036720] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614] [ENSMUST00000174796]

Predicted Effect

probably benign
Transcript: ENSMUST00000015605

SMART Domains

Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461

Domain	Start	End	E-Value	Type
low complexity region	86	110	N/A	INTRINSIC
internal_repeat_1	113	156	2.55e-13	PROSPERO
low complexity region	162	180	N/A	INTRINSIC
internal_repeat_1	186	230	2.55e-13	PROSPERO
low complexity region	238	255	N/A	INTRINSIC
low complexity region	289	301	N/A	INTRINSIC
BRLZ	320	384	7.08e-15	SMART
low complexity region	415	428	N/A	INTRINSIC
low complexity region	484	497	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	667	693	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000036720
AA Change: A24T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000037273
Gene: ENSMUSG00000033739
AA Change: A24T

Domain	Start	End	E-Value	Type
TPR	208	241	2.92e1	SMART
TPR	250	283	4.77e-2	SMART
TPR	284	317	1.89e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000173984

SMART Domains

Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461

Domain	Start	End	E-Value	Type
low complexity region	89	113	N/A	INTRINSIC
internal_repeat_1	116	159	2.54e-13	PROSPERO
low complexity region	165	183	N/A	INTRINSIC
internal_repeat_1	189	233	2.54e-13	PROSPERO
low complexity region	241	258	N/A	INTRINSIC
low complexity region	292	304	N/A	INTRINSIC
BRLZ	323	387	2.9e-17	SMART
low complexity region	418	431	N/A	INTRINSIC
low complexity region	487	500	N/A	INTRINSIC
low complexity region	547	560	N/A	INTRINSIC
low complexity region	670	696	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174519

SMART Domains

Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

Domain	Start	End	E-Value	Type
low complexity region	23	47	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174600

Predicted Effect

probably benign
Transcript: ENSMUST00000174614

Predicted Effect

probably benign
Transcript: ENSMUST00000174796

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The encoded protein is thought to have a potential role in the induced radioresistance. Also it appears to have some involvement in the control of the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality. Heterozygotes develop normally but exhibit enhanced angiogenesis in various experimental and tumor disease models. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,387	V17D	probably damaging	Het
Abcb1a	C	A	5: 8,702,946	Q566K	probably damaging	Het
Adam26a	A	T	8: 43,569,104	C450S	probably damaging	Het
Adar	C	T	3: 89,736,111	P433L	probably damaging	Het
Aldh1a2	G	T	9: 71,255,121	A151S	possibly damaging	Het
Arsk	T	A	13: 76,093,947	H69L	probably benign	Het
Atf6b	T	A	17: 34,653,797	Y600*	probably null	Het
Blk	C	A	14: 63,380,731	G242V	probably damaging	Het
Bmt2	A	T	6: 13,677,832	M1K	probably null	Het
Catsperg1	G	A	7: 29,185,523	T891M	probably damaging	Het
Ccdc32	A	C	2: 119,022,079	S131A	possibly damaging	Het
Cdh8	A	G	8: 99,196,370	V298A	probably damaging	Het
Cfap54	T	A	10: 93,001,858	Q1060L	probably benign	Het
Cfap58	G	A	19: 48,029,102	M800I	possibly damaging	Het
Cntn5	A	T	9: 9,833,460	V362D	probably damaging	Het
G2e3	T	C	12: 51,372,666	S699P	probably damaging	Het
Gbp4	G	T	5: 105,119,521	Q511K	possibly damaging	Het
Gdap2	T	A	3: 100,191,675	I361N	probably damaging	Het
Ino80c	T	A	18: 24,112,762	H92L	probably benign	Het
Lipo4	A	G	19: 33,503,218	V250A	probably benign	Het
Llgl1	C	T	11: 60,713,184	R1055W	probably damaging	Het
Lrriq3	T	C	3: 155,129,501		probably null	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Ncstn	A	G	1: 172,072,164	V317A	probably benign	Het
Nfxl1	G	A	5: 72,556,198	T134I	possibly damaging	Het
Nup155	A	T	15: 8,153,638		probably null	Het
Nup214	C	A	2: 32,002,607	P680T	probably damaging	Het
Olfr805	G	A	10: 129,722,930	L205F	probably damaging	Het
Olfr871	A	G	9: 20,213,158	K270E	probably benign	Het
Olfr874	A	G	9: 37,746,647	N171S	probably benign	Het
Olfr877	G	A	9: 37,855,219	V134I	probably benign	Het
Pkd2	T	C	5: 104,480,332	F424S	probably damaging	Het
Plb1	A	G	5: 32,341,915	D1074G	probably damaging	Het
Ppm1l	T	C	3: 69,317,594	S10P	possibly damaging	Het
Rnf213	A	G	11: 119,440,808	H2281R	probably damaging	Het
Rpa2	G	T	4: 132,776,248	A3S	probably benign	Het
Sardh	A	G	2: 27,211,084	V698A	possibly damaging	Het
Saxo2	A	T	7: 82,635,378	C91S	probably benign	Het
Slc3a2	T	C	19: 8,708,042	D198G	probably damaging	Het
Spata31d1d	T	A	13: 59,728,778	E314D	probably benign	Het
Sptlc3	T	C	2: 139,546,478	V130A	probably benign	Het
Stpg3	C	A	2: 25,213,568	E115*	probably null	Het
Tbcd	T	A	11: 121,452,101	D19E	probably benign	Het
Xrcc3	T	C	12: 111,812,111	D2G	probably damaging	Het

Other mutations in Fkbpl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01085:Fkbpl	APN	17	34645744	missense	probably damaging	1.00
IGL02129:Fkbpl	APN	17	34645978	missense	probably damaging	0.99
IGL02322:Fkbpl	APN	17	34645324	missense	probably benign	0.00
IGL03331:Fkbpl	APN	17	34645687	missense	probably damaging	1.00
IGL03347:Fkbpl	APN	17	34646313	unclassified	probably benign
R0278:Fkbpl	UTSW	17	34645410	nonsense	probably null
R0314:Fkbpl	UTSW	17	34646052	missense	possibly damaging	0.62
R0540:Fkbpl	UTSW	17	34645359	missense	probably benign
R0607:Fkbpl	UTSW	17	34645359	missense	probably benign
R1866:Fkbpl	UTSW	17	34645823	missense	possibly damaging	0.50
R4483:Fkbpl	UTSW	17	34646295	missense	probably damaging	1.00
R4746:Fkbpl	UTSW	17	34645329	missense	probably benign
R4795:Fkbpl	UTSW	17	34645329	missense	probably benign
R4796:Fkbpl	UTSW	17	34645329	missense	probably benign
R4839:Fkbpl	UTSW	17	34645865	missense	probably benign
R5268:Fkbpl	UTSW	17	34645329	missense	probably benign
R5290:Fkbpl	UTSW	17	34645329	missense	probably benign
R5357:Fkbpl	UTSW	17	34645329	missense	probably benign
R5358:Fkbpl	UTSW	17	34645329	missense	probably benign
R5359:Fkbpl	UTSW	17	34645329	missense	probably benign
R5360:Fkbpl	UTSW	17	34645329	missense	probably benign
R5361:Fkbpl	UTSW	17	34645329	missense	probably benign
R5363:Fkbpl	UTSW	17	34645329	missense	probably benign
R5435:Fkbpl	UTSW	17	34645329	missense	probably benign
R5533:Fkbpl	UTSW	17	34645329	missense	probably benign
R5535:Fkbpl	UTSW	17	34645329	missense	probably benign
R5722:Fkbpl	UTSW	17	34645329	missense	probably benign
R5723:Fkbpl	UTSW	17	34645329	missense	probably benign
R5760:Fkbpl	UTSW	17	34645329	missense	probably benign
R5861:Fkbpl	UTSW	17	34645329	missense	probably benign
R5941:Fkbpl	UTSW	17	34645329	missense	probably benign
R6109:Fkbpl	UTSW	17	34645329	missense	probably benign
R6124:Fkbpl	UTSW	17	34645329	missense	probably benign
R6146:Fkbpl	UTSW	17	34645329	missense	probably benign
R6148:Fkbpl	UTSW	17	34645329	missense	probably benign
R6185:Fkbpl	UTSW	17	34645329	missense	probably benign
R6186:Fkbpl	UTSW	17	34645329	missense	probably benign
R6186:Fkbpl	UTSW	17	34646179	missense	probably benign	0.12
R6344:Fkbpl	UTSW	17	34645570	missense	probably damaging	1.00
R6481:Fkbpl	UTSW	17	34645414	missense	possibly damaging	0.95
R6564:Fkbpl	UTSW	17	34646266	missense	probably benign	0.42

Predicted Primers

PCR Primer
(F):5'- CGAGGAGTCTTAACTAGGAATTCTG -3'
(R):5'- AGGTGCTCTGCCATCTCATTG -3'

Sequencing Primer
(F):5'- AATTCTGGAATTTACATGGTTTCGG -3'
(R):5'- TGGTTGAGACTTGAAATTGATCAGAG -3'

Posted On

2016-09-01