Incidental Mutation 'R5406:Fkbpl'
ID426298
Institutional Source Beutler Lab
Gene Symbol Fkbpl
Ensembl Gene ENSMUSG00000033739
Gene NameFK506 binding protein-like
SynonymsWAF-1/CIP1 stabilizing protein 39, NG7, DIR1, Ppiase-X, WISp39
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.919) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34644764-34646324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34645329 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 24 (A24T)
Ref Sequence ENSEMBL: ENSMUSP00000037273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000036720] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614] [ENSMUST00000174796]
Predicted Effect probably benign
Transcript: ENSMUST00000015605
SMART Domains Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 86 110 N/A INTRINSIC
internal_repeat_1 113 156 2.55e-13 PROSPERO
low complexity region 162 180 N/A INTRINSIC
internal_repeat_1 186 230 2.55e-13 PROSPERO
low complexity region 238 255 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
BRLZ 320 384 7.08e-15 SMART
low complexity region 415 428 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036720
AA Change: A24T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037273
Gene: ENSMUSG00000033739
AA Change: A24T

DomainStartEndE-ValueType
TPR 208 241 2.92e1 SMART
TPR 250 283 4.77e-2 SMART
TPR 284 317 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173984
SMART Domains Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 89 113 N/A INTRINSIC
internal_repeat_1 116 159 2.54e-13 PROSPERO
low complexity region 165 183 N/A INTRINSIC
internal_repeat_1 189 233 2.54e-13 PROSPERO
low complexity region 241 258 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
BRLZ 323 387 2.9e-17 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
low complexity region 547 560 N/A INTRINSIC
low complexity region 670 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174519
SMART Domains Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174600
Predicted Effect probably benign
Transcript: ENSMUST00000174614
Predicted Effect probably benign
Transcript: ENSMUST00000174796
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The encoded protein is thought to have a potential role in the induced radioresistance. Also it appears to have some involvement in the control of the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality. Heterozygotes develop normally but exhibit enhanced angiogenesis in various experimental and tumor disease models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Fkbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Fkbpl APN 17 34645744 missense probably damaging 1.00
IGL02129:Fkbpl APN 17 34645978 missense probably damaging 0.99
IGL02322:Fkbpl APN 17 34645324 missense probably benign 0.00
IGL03331:Fkbpl APN 17 34645687 missense probably damaging 1.00
IGL03347:Fkbpl APN 17 34646313 unclassified probably benign
R0278:Fkbpl UTSW 17 34645410 nonsense probably null
R0314:Fkbpl UTSW 17 34646052 missense possibly damaging 0.62
R0540:Fkbpl UTSW 17 34645359 missense probably benign
R0607:Fkbpl UTSW 17 34645359 missense probably benign
R1866:Fkbpl UTSW 17 34645823 missense possibly damaging 0.50
R4483:Fkbpl UTSW 17 34646295 missense probably damaging 1.00
R4746:Fkbpl UTSW 17 34645329 missense probably benign
R4795:Fkbpl UTSW 17 34645329 missense probably benign
R4796:Fkbpl UTSW 17 34645329 missense probably benign
R4839:Fkbpl UTSW 17 34645865 missense probably benign
R5268:Fkbpl UTSW 17 34645329 missense probably benign
R5290:Fkbpl UTSW 17 34645329 missense probably benign
R5357:Fkbpl UTSW 17 34645329 missense probably benign
R5358:Fkbpl UTSW 17 34645329 missense probably benign
R5359:Fkbpl UTSW 17 34645329 missense probably benign
R5360:Fkbpl UTSW 17 34645329 missense probably benign
R5361:Fkbpl UTSW 17 34645329 missense probably benign
R5363:Fkbpl UTSW 17 34645329 missense probably benign
R5435:Fkbpl UTSW 17 34645329 missense probably benign
R5533:Fkbpl UTSW 17 34645329 missense probably benign
R5535:Fkbpl UTSW 17 34645329 missense probably benign
R5722:Fkbpl UTSW 17 34645329 missense probably benign
R5723:Fkbpl UTSW 17 34645329 missense probably benign
R5760:Fkbpl UTSW 17 34645329 missense probably benign
R5861:Fkbpl UTSW 17 34645329 missense probably benign
R5941:Fkbpl UTSW 17 34645329 missense probably benign
R6109:Fkbpl UTSW 17 34645329 missense probably benign
R6124:Fkbpl UTSW 17 34645329 missense probably benign
R6146:Fkbpl UTSW 17 34645329 missense probably benign
R6148:Fkbpl UTSW 17 34645329 missense probably benign
R6185:Fkbpl UTSW 17 34645329 missense probably benign
R6186:Fkbpl UTSW 17 34645329 missense probably benign
R6186:Fkbpl UTSW 17 34646179 missense probably benign 0.12
R6344:Fkbpl UTSW 17 34645570 missense probably damaging 1.00
R6481:Fkbpl UTSW 17 34645414 missense possibly damaging 0.95
R6564:Fkbpl UTSW 17 34646266 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- CGAGGAGTCTTAACTAGGAATTCTG -3'
(R):5'- AGGTGCTCTGCCATCTCATTG -3'

Sequencing Primer
(F):5'- AATTCTGGAATTTACATGGTTTCGG -3'
(R):5'- TGGTTGAGACTTGAAATTGATCAGAG -3'
Posted On2016-09-01