Mutagenetix > Incidental Mutations

Incidental Mutation 'R5406:Atf6b'

426299

Institutional Source

Beutler Lab

Gene Symbol

Atf6b

Ensembl Gene

ENSMUSG00000015461

Gene Name

activating transcription factor 6 beta

Synonyms

Creb-rp, ATF6beta, Crebl1

MMRRC Submission

042976-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.722) question?

Stock #

R5406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

34647146-34655074 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 34653797 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 600 (Y600*)

Ref Sequence

ENSEMBL: ENSMUSP00000133516 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614]

Predicted Effect

probably null
Transcript: ENSMUST00000015605
AA Change: Y597*

SMART Domains

Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461
AA Change: Y597*

Domain	Start	End	E-Value	Type
low complexity region	86	110	N/A	INTRINSIC
internal_repeat_1	113	156	2.55e-13	PROSPERO
low complexity region	162	180	N/A	INTRINSIC
internal_repeat_1	186	230	2.55e-13	PROSPERO
low complexity region	238	255	N/A	INTRINSIC
low complexity region	289	301	N/A	INTRINSIC
BRLZ	320	384	7.08e-15	SMART
low complexity region	415	428	N/A	INTRINSIC
low complexity region	484	497	N/A	INTRINSIC
low complexity region	544	557	N/A	INTRINSIC
low complexity region	667	693	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000173984
AA Change: Y600*

SMART Domains

Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461
AA Change: Y600*

Domain	Start	End	E-Value	Type
low complexity region	89	113	N/A	INTRINSIC
internal_repeat_1	116	159	2.54e-13	PROSPERO
low complexity region	165	183	N/A	INTRINSIC
internal_repeat_1	189	233	2.54e-13	PROSPERO
low complexity region	241	258	N/A	INTRINSIC
low complexity region	292	304	N/A	INTRINSIC
BRLZ	323	387	2.9e-17	SMART
low complexity region	418	431	N/A	INTRINSIC
low complexity region	487	500	N/A	INTRINSIC
low complexity region	547	560	N/A	INTRINSIC
low complexity region	670	696	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000174156

Predicted Effect

probably benign
Transcript: ENSMUST00000174519

SMART Domains

Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

Domain	Start	End	E-Value	Type
low complexity region	23	47	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174614

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcription factor in the unfolded protein response (UPR) pathway during ER stress. Either as a homodimer or as a heterodimer with ATF6-alpha, the encoded protein binds to the ER stress response element, interacting with nuclear transcription factor Y to activate UPR target genes. The protein is normally found in the membrane of the endoplasmic reticulum; however, under ER stress, the N-terminal cytoplasmic domain is cleaved from the rest of the protein and translocates to the nucleus. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit increased cellular sensitivity to thapsigargin and tunicamycin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aasdhppt	A	T	9: 4,309,387	V17D	probably damaging	Het
Abcb1a	C	A	5: 8,702,946	Q566K	probably damaging	Het
Adam26a	A	T	8: 43,569,104	C450S	probably damaging	Het
Adar	C	T	3: 89,736,111	P433L	probably damaging	Het
Aldh1a2	G	T	9: 71,255,121	A151S	possibly damaging	Het
Arsk	T	A	13: 76,093,947	H69L	probably benign	Het
Blk	C	A	14: 63,380,731	G242V	probably damaging	Het
Bmt2	A	T	6: 13,677,832	M1K	probably null	Het
Catsperg1	G	A	7: 29,185,523	T891M	probably damaging	Het
Ccdc32	A	C	2: 119,022,079	S131A	possibly damaging	Het
Cdh8	A	G	8: 99,196,370	V298A	probably damaging	Het
Cfap54	T	A	10: 93,001,858	Q1060L	probably benign	Het
Cfap58	G	A	19: 48,029,102	M800I	possibly damaging	Het
Cntn5	A	T	9: 9,833,460	V362D	probably damaging	Het
Fkbpl	G	A	17: 34,645,329	A24T	probably benign	Het
G2e3	T	C	12: 51,372,666	S699P	probably damaging	Het
Gbp4	G	T	5: 105,119,521	Q511K	possibly damaging	Het
Gdap2	T	A	3: 100,191,675	I361N	probably damaging	Het
Ino80c	T	A	18: 24,112,762	H92L	probably benign	Het
Lipo4	A	G	19: 33,503,218	V250A	probably benign	Het
Llgl1	C	T	11: 60,713,184	R1055W	probably damaging	Het
Lrriq3	T	C	3: 155,129,501		probably null	Het
Mmp1a	A	G	9: 7,467,293	E290G	probably damaging	Het
Ncstn	A	G	1: 172,072,164	V317A	probably benign	Het
Nfxl1	G	A	5: 72,556,198	T134I	possibly damaging	Het
Nup155	A	T	15: 8,153,638		probably null	Het
Nup214	C	A	2: 32,002,607	P680T	probably damaging	Het
Olfr805	G	A	10: 129,722,930	L205F	probably damaging	Het
Olfr871	A	G	9: 20,213,158	K270E	probably benign	Het
Olfr874	A	G	9: 37,746,647	N171S	probably benign	Het
Olfr877	G	A	9: 37,855,219	V134I	probably benign	Het
Pkd2	T	C	5: 104,480,332	F424S	probably damaging	Het
Plb1	A	G	5: 32,341,915	D1074G	probably damaging	Het
Ppm1l	T	C	3: 69,317,594	S10P	possibly damaging	Het
Rnf213	A	G	11: 119,440,808	H2281R	probably damaging	Het
Rpa2	G	T	4: 132,776,248	A3S	probably benign	Het
Sardh	A	G	2: 27,211,084	V698A	possibly damaging	Het
Saxo2	A	T	7: 82,635,378	C91S	probably benign	Het
Slc3a2	T	C	19: 8,708,042	D198G	probably damaging	Het
Spata31d1d	T	A	13: 59,728,778	E314D	probably benign	Het
Sptlc3	T	C	2: 139,546,478	V130A	probably benign	Het
Stpg3	C	A	2: 25,213,568	E115*	probably null	Het
Tbcd	T	A	11: 121,452,101	D19E	probably benign	Het
Xrcc3	T	C	12: 111,812,111	D2G	probably damaging	Het

Other mutations in Atf6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01592:Atf6b	APN	17	34649137	missense	probably damaging	0.99
IGL02010:Atf6b	APN	17	34654652	missense	probably benign	0.00
IGL02023:Atf6b	APN	17	34651867	missense	possibly damaging	0.93
IGL02141:Atf6b	APN	17	34653277	missense	probably benign	0.01
IGL02511:Atf6b	APN	17	34654641	missense	probably benign	0.01
IGL03347:Atf6b	APN	17	34653240	missense	probably damaging	1.00
R0112:Atf6b	UTSW	17	34651626	missense	probably damaging	0.97
R0285:Atf6b	UTSW	17	34650396	unclassified	probably benign
R0544:Atf6b	UTSW	17	34648299	critical splice donor site	probably null
R1618:Atf6b	UTSW	17	34647728	nonsense	probably null
R1689:Atf6b	UTSW	17	34650302	missense	probably damaging	0.98
R1823:Atf6b	UTSW	17	34648644	missense	possibly damaging	0.48
R1996:Atf6b	UTSW	17	34652987	critical splice acceptor site	probably null
R2057:Atf6b	UTSW	17	34648575	critical splice acceptor site	probably null
R2058:Atf6b	UTSW	17	34648575	critical splice acceptor site	probably null
R2059:Atf6b	UTSW	17	34648575	critical splice acceptor site	probably null
R4290:Atf6b	UTSW	17	34652674	missense	probably benign	0.00
R4291:Atf6b	UTSW	17	34652674	missense	probably benign	0.00
R4293:Atf6b	UTSW	17	34652674	missense	probably benign	0.00
R4880:Atf6b	UTSW	17	34654555	missense	probably damaging	1.00
R4893:Atf6b	UTSW	17	34648612	missense	probably damaging	1.00
R5549:Atf6b	UTSW	17	34651683	missense	probably damaging	1.00
R5702:Atf6b	UTSW	17	34651004	missense	possibly damaging	0.93
R6386:Atf6b	UTSW	17	34651851	missense	probably damaging	0.97
R6833:Atf6b	UTSW	17	34649157	missense	probably damaging	1.00
R6834:Atf6b	UTSW	17	34649157	missense	probably damaging	1.00
R7094:Atf6b	UTSW	17	34653816	critical splice donor site	probably null
R7205:Atf6b	UTSW	17	34653729	missense	probably damaging	1.00
R7261:Atf6b	UTSW	17	34650818	missense	probably damaging	0.96
R7969:Atf6b	UTSW	17	34648575	critical splice acceptor site	probably null
R8103:Atf6b	UTSW	17	34653975	missense	probably damaging	1.00
R8179:Atf6b	UTSW	17	34653994	missense	probably damaging	0.99
R8355:Atf6b	UTSW	17	34648223	missense	probably benign	0.01
R8455:Atf6b	UTSW	17	34648223	missense	probably benign	0.01
R8499:Atf6b	UTSW	17	34650822	missense	probably damaging	1.00
R8685:Atf6b	UTSW	17	34650346	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- AGGACACTGCTGTTGTTCCG -3'
(R):5'- TCCATAGCCAGAGGGAGAATTAC -3'

Sequencing Primer
(F):5'- GGAGGAATCTGTCACCCTTTC -3'
(R):5'- ATCACCAGCGACATCTTGGG -3'

Posted On

2016-09-01