Incidental Mutation 'R5406:Ino80c'
ID426300
Institutional Source Beutler Lab
Gene Symbol Ino80c
Ensembl Gene ENSMUSG00000047989
Gene NameINO80 complex subunit C
Synonyms
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.907) question?
Stock #R5406 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location24104757-24121953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24112762 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 92 (H92L)
Ref Sequence ENSEMBL: ENSMUSP00000055342 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055012] [ENSMUST00000125169] [ENSMUST00000141489] [ENSMUST00000153360]
Predicted Effect probably benign
Transcript: ENSMUST00000055012
AA Change: H92L

PolyPhen 2 Score 0.176 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000055342
Gene: ENSMUSG00000047989
AA Change: H92L

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125169
AA Change: H35L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000117684
Gene: ENSMUSG00000047989
AA Change: H35L

DomainStartEndE-ValueType
YL1_C 83 112 2.99e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141489
SMART Domains Protein: ENSMUSP00000122372
Gene: ENSMUSG00000047989

DomainStartEndE-ValueType
YL1_C 43 72 1.73e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153360
AA Change: H92L

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000114643
Gene: ENSMUSG00000047989
AA Change: H92L

DomainStartEndE-ValueType
low complexity region 31 48 N/A INTRINSIC
YL1_C 140 169 2.99e-9 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Slc3a2 T C 19: 8,708,042 D198G probably damaging Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Ino80c
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0063:Ino80c UTSW 18 24106624 missense probably damaging 0.98
R2017:Ino80c UTSW 18 24111753 nonsense probably null
R3800:Ino80c UTSW 18 24121695 missense probably damaging 1.00
R4688:Ino80c UTSW 18 24108846 missense probably damaging 1.00
R4711:Ino80c UTSW 18 24114165 missense probably benign 0.00
R4966:Ino80c UTSW 18 24106645 missense probably damaging 1.00
R5144:Ino80c UTSW 18 24108878 missense probably benign 0.40
R6909:Ino80c UTSW 18 24108755 intron probably benign
R7419:Ino80c UTSW 18 24108779 missense unknown
R7470:Ino80c UTSW 18 24108838 nonsense probably null
R8071:Ino80c UTSW 18 24106650 missense unknown
Predicted Primers PCR Primer
(F):5'- AGCAAATAACGTAGGCTTGTTG -3'
(R):5'- ACTTGTGGGTTTGAAGAGCC -3'

Sequencing Primer
(F):5'- CAAATAACGTAGGCTTGTTGTAAGG -3'
(R):5'- TTGATAAAGGTCACCTGTAGCCCAG -3'
Posted On2016-09-01