Incidental Mutation 'R5406:Slc3a2'
ID426301
Institutional Source Beutler Lab
Gene Symbol Slc3a2
Ensembl Gene ENSMUSG00000010095
Gene Namesolute carrier family 3 (activators of dibasic and neutral amino acid transport), member 2
SynonymsLy-10, Mgp-2hc, Cd98, 4F2HC, Ly-m10, Mdu1
MMRRC Submission 042976-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5406 (G1)
Quality Score216
Status Not validated
Chromosome19
Chromosomal Location8706882-8723369 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 8708042 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 198 (D198G)
Ref Sequence ENSEMBL: ENSMUSP00000146016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010239] [ENSMUST00000170157] [ENSMUST00000205377] [ENSMUST00000206598] [ENSMUST00000206797]
Predicted Effect probably damaging
Transcript: ENSMUST00000010239
AA Change: D421G

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000010239
Gene: ENSMUSG00000010095
AA Change: D421G

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
Pfam:Alpha-amylase 132 219 8.2e-15 PFAM
low complexity region 286 305 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000170157
AA Change: D460G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000130194
Gene: ENSMUSG00000010095
AA Change: D460G

DomainStartEndE-ValueType
Pfam:SLC3A2_N 79 157 9.3e-35 PFAM
Pfam:Alpha-amylase 171 258 1.7e-15 PFAM
low complexity region 325 344 N/A INTRINSIC
low complexity region 382 393 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205377
Predicted Effect probably benign
Transcript: ENSMUST00000205463
Predicted Effect probably damaging
Transcript: ENSMUST00000206598
AA Change: D198G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000206797
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family and encodes a cell surface, transmembrane protein. The protein exists as the heavy chain of a heterodimer, covalently bound through di-sulfide bonds to one of several possible light chains. The encoded transporter plays a role in regulation of intracellular calcium levels and transports L-type amino acids. Alternatively spliced transcript variants, encoding different isoforms, have been characterized. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous mutant mice display embryonic lethality. Mice homozygous for a conditional allele activated in the intestinal epithelia exhibit resistance to decreased susceptibility to induced colitis and colitis-associated cancer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt A T 9: 4,309,387 V17D probably damaging Het
Abcb1a C A 5: 8,702,946 Q566K probably damaging Het
Adam26a A T 8: 43,569,104 C450S probably damaging Het
Adar C T 3: 89,736,111 P433L probably damaging Het
Aldh1a2 G T 9: 71,255,121 A151S possibly damaging Het
Arsk T A 13: 76,093,947 H69L probably benign Het
Atf6b T A 17: 34,653,797 Y600* probably null Het
Blk C A 14: 63,380,731 G242V probably damaging Het
Bmt2 A T 6: 13,677,832 M1K probably null Het
Catsperg1 G A 7: 29,185,523 T891M probably damaging Het
Ccdc32 A C 2: 119,022,079 S131A possibly damaging Het
Cdh8 A G 8: 99,196,370 V298A probably damaging Het
Cfap54 T A 10: 93,001,858 Q1060L probably benign Het
Cfap58 G A 19: 48,029,102 M800I possibly damaging Het
Cntn5 A T 9: 9,833,460 V362D probably damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
G2e3 T C 12: 51,372,666 S699P probably damaging Het
Gbp4 G T 5: 105,119,521 Q511K possibly damaging Het
Gdap2 T A 3: 100,191,675 I361N probably damaging Het
Ino80c T A 18: 24,112,762 H92L probably benign Het
Lipo4 A G 19: 33,503,218 V250A probably benign Het
Llgl1 C T 11: 60,713,184 R1055W probably damaging Het
Lrriq3 T C 3: 155,129,501 probably null Het
Mmp1a A G 9: 7,467,293 E290G probably damaging Het
Ncstn A G 1: 172,072,164 V317A probably benign Het
Nfxl1 G A 5: 72,556,198 T134I possibly damaging Het
Nup155 A T 15: 8,153,638 probably null Het
Nup214 C A 2: 32,002,607 P680T probably damaging Het
Olfr805 G A 10: 129,722,930 L205F probably damaging Het
Olfr871 A G 9: 20,213,158 K270E probably benign Het
Olfr874 A G 9: 37,746,647 N171S probably benign Het
Olfr877 G A 9: 37,855,219 V134I probably benign Het
Pkd2 T C 5: 104,480,332 F424S probably damaging Het
Plb1 A G 5: 32,341,915 D1074G probably damaging Het
Ppm1l T C 3: 69,317,594 S10P possibly damaging Het
Rnf213 A G 11: 119,440,808 H2281R probably damaging Het
Rpa2 G T 4: 132,776,248 A3S probably benign Het
Sardh A G 2: 27,211,084 V698A possibly damaging Het
Saxo2 A T 7: 82,635,378 C91S probably benign Het
Spata31d1d T A 13: 59,728,778 E314D probably benign Het
Sptlc3 T C 2: 139,546,478 V130A probably benign Het
Stpg3 C A 2: 25,213,568 E115* probably null Het
Tbcd T A 11: 121,452,101 D19E probably benign Het
Xrcc3 T C 12: 111,812,111 D2G probably damaging Het
Other mutations in Slc3a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01374:Slc3a2 APN 19 8713337 splice site probably null
IGL02541:Slc3a2 APN 19 8707759 nonsense probably null
R0145:Slc3a2 UTSW 19 8708073 missense probably damaging 1.00
R1015:Slc3a2 UTSW 19 8707955 nonsense probably null
R2135:Slc3a2 UTSW 19 8708244 missense probably benign 0.04
R5464:Slc3a2 UTSW 19 8713644 missense probably damaging 1.00
R5603:Slc3a2 UTSW 19 8713728 missense probably benign 0.43
R5715:Slc3a2 UTSW 19 8708230 missense probably benign
R5949:Slc3a2 UTSW 19 8713395 missense probably damaging 1.00
R6466:Slc3a2 UTSW 19 8709319 missense probably damaging 1.00
R6594:Slc3a2 UTSW 19 8708046 missense probably damaging 1.00
R6860:Slc3a2 UTSW 19 8713632 missense probably damaging 1.00
R6971:Slc3a2 UTSW 19 8709610 critical splice acceptor site probably null
R7252:Slc3a2 UTSW 19 8723157 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GCACTGTCGGTACTAAGCAAAAG -3'
(R):5'- CCTGTAAGCCTCAACATGACAG -3'

Sequencing Primer
(F):5'- TCGGTACTAAGCAAAAGTTTAGCGC -3'
(R):5'- CTGTAAGCCTCAACATGACAGTGAAG -3'
Posted On2016-09-01