Incidental Mutation 'R5407:Gabrb1'
ID426322
Institutional Source Beutler Lab
Gene Symbol Gabrb1
Ensembl Gene ENSMUSG00000029212
Gene Namegamma-aminobutyric acid (GABA) A receptor, subunit beta 1
SynonymsGabrb-1, B230208N19Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5407 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location71658113-72149037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 72122021 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 303 (V303A)
Ref Sequence ENSEMBL: ENSMUSP00000031122 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031122]
Predicted Effect possibly damaging
Transcript: ENSMUST00000031122
AA Change: V303A

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000031122
Gene: ENSMUSG00000029212
AA Change: V303A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Neur_chan_LBD 37 243 7.1e-52 PFAM
Pfam:Neur_chan_memb 250 469 2.4e-48 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gamma-aminobutyric acid (GABA) A receptor is a multisubunit chloride channel that mediates the fastest inhibitory synaptic transmission in the central nervous system. This gene encodes GABA A receptor, beta 1 subunit. It is mapped to chromosome 4p12 in a cluster comprised of genes encoding alpha 4, alpha 2 and gamma 1 subunits of the GABA A receptor. Alteration of this gene is implicated in the pathogenetics of schizophrenia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous for an ENU or spontaneous mutation exhibit alcohol preference with increased tonic inhibition, female infertility and hypothalamic pituitary axis dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A C 12: 55,566,196 Y302S probably damaging Het
Arpp21 G T 9: 112,116,753 probably benign Het
Camk1g C T 1: 193,347,372 probably null Het
Cand2 G A 6: 115,785,200 V196I possibly damaging Het
Cdc25b T A 2: 131,193,647 L381Q probably damaging Het
Col17a1 C T 19: 47,666,507 G610E probably damaging Het
Col19a1 C T 1: 24,303,494 E797K probably damaging Het
Col3a1 A T 1: 45,346,052 I110L probably benign Het
Col5a2 T A 1: 45,406,280 D506V possibly damaging Het
Crp A T 1: 172,698,109 probably null Het
Esco1 G T 18: 10,574,886 H729N probably damaging Het
Evx2 A G 2: 74,657,826 S217P probably damaging Het
Gcnt3 A G 9: 70,034,189 Y366H probably benign Het
Gm436 T C 4: 144,670,325 K279R probably benign Het
Gmpr2 A G 14: 55,678,276 T304A possibly damaging Het
Golga3 C T 5: 110,201,990 Q656* probably null Het
Gramd1b T A 9: 40,455,655 M6L probably damaging Het
Kif17 T C 4: 138,298,221 Y945H probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lrrk1 T A 7: 66,270,797 Q1486L probably benign Het
Mboat7 G T 7: 3,691,381 H72N probably damaging Het
Med12l G A 3: 59,258,201 V1447M probably damaging Het
Mrpl3 T C 9: 105,077,095 F333L probably benign Het
Nav3 T C 10: 109,866,935 T246A probably benign Het
Neil3 A T 8: 53,601,019 V325E probably benign Het
Nlrp4g A T 9: 124,349,930 noncoding transcript Het
Olfr148 A T 9: 39,613,695 I43F probably damaging Het
Onecut1 C T 9: 74,889,456 S419F probably damaging Het
Ptp4a1 A T 1: 30,944,963 V58E probably benign Het
Radil C T 5: 142,508,215 R49H probably damaging Het
Ralgapa1 T C 12: 55,676,797 E1648G possibly damaging Het
Rnft2 C T 5: 118,242,502 M13I probably damaging Het
Satb2 A G 1: 56,948,150 L92P probably damaging Het
Scn4a T C 11: 106,320,889 Y1434C probably damaging Het
Setx T A 2: 29,145,474 M657K probably benign Het
Shd A G 17: 55,973,936 E204G probably damaging Het
Shh T A 5: 28,466,580 R62* probably null Het
Slc9a4 A G 1: 40,607,794 T483A probably benign Het
Tbc1d7 A C 13: 43,154,702 S96A probably benign Het
Tfcp2 T C 15: 100,527,874 probably null Het
Tlk2 T A 11: 105,240,375 S182R probably damaging Het
Tppp2 A G 14: 51,919,498 probably null Het
Trim65 T C 11: 116,126,080 T519A probably benign Het
Trio T C 15: 27,844,806 probably null Het
Usf3 G A 16: 44,217,406 V750I probably benign Het
Utrn T A 10: 12,680,625 K1480N probably damaging Het
Vmn1r58 T A 7: 5,410,873 R119S probably benign Het
Xirp2 A G 2: 67,510,969 I1185V probably benign Het
Zc3h7b A G 15: 81,785,891 H654R probably damaging Het
Zfyve16 G T 13: 92,500,284 A1306E probably damaging Het
Other mutations in Gabrb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00770:Gabrb1 APN 5 72108446 critical splice donor site probably null
IGL00774:Gabrb1 APN 5 72108446 critical splice donor site probably null
IGL01534:Gabrb1 APN 5 71869429 missense possibly damaging 0.95
IGL02170:Gabrb1 APN 5 72136730 missense probably damaging 1.00
IGL02326:Gabrb1 APN 5 71700847 missense probably damaging 0.99
IGL03278:Gabrb1 APN 5 71869596 missense probably damaging 1.00
IGL03345:Gabrb1 APN 5 72136565 missense possibly damaging 0.53
IGL03050:Gabrb1 UTSW 5 72122154 missense probably benign 0.03
PIT4445001:Gabrb1 UTSW 5 72108782 missense probably damaging 1.00
PIT4515001:Gabrb1 UTSW 5 71700817 missense probably damaging 1.00
R0109:Gabrb1 UTSW 5 72121946 splice site probably benign
R0386:Gabrb1 UTSW 5 72108807 missense probably damaging 0.99
R1512:Gabrb1 UTSW 5 72108704 missense probably damaging 1.00
R1512:Gabrb1 UTSW 5 72108705 missense probably damaging 1.00
R1717:Gabrb1 UTSW 5 72108351 synonymous probably null
R1832:Gabrb1 UTSW 5 72121938 splice site probably null
R1961:Gabrb1 UTSW 5 71700336 missense probably benign 0.28
R2363:Gabrb1 UTSW 5 71869573 nonsense probably null
R4686:Gabrb1 UTSW 5 71700022 missense possibly damaging 0.53
R4840:Gabrb1 UTSW 5 71700811 missense probably damaging 1.00
R4916:Gabrb1 UTSW 5 71869421 missense probably damaging 1.00
R4941:Gabrb1 UTSW 5 72136778 missense probably damaging 1.00
R5250:Gabrb1 UTSW 5 71869579 missense possibly damaging 0.80
R5270:Gabrb1 UTSW 5 72108326 missense probably damaging 1.00
R5364:Gabrb1 UTSW 5 72136762 missense probably benign 0.33
R5621:Gabrb1 UTSW 5 72108728 missense probably damaging 1.00
R5790:Gabrb1 UTSW 5 72136484 missense possibly damaging 0.53
R6236:Gabrb1 UTSW 5 72108320 missense probably damaging 1.00
R6336:Gabrb1 UTSW 5 72029898 missense possibly damaging 0.72
R7411:Gabrb1 UTSW 5 72122195 critical splice donor site probably null
R8375:Gabrb1 UTSW 5 72029829 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGTCCTGCCATCAATTGTACTG -3'
(R):5'- GACGGGATTAGCAATATACAATGCC -3'

Sequencing Primer
(F):5'- CATCAATTGTACTGCACTGTGGCAG -3'
(R):5'- ACAATGCCTTACTTGGACTTTG -3'
Posted On2016-09-01