Incidental Mutation 'R5407:Gcnt3'
ID426333
Institutional Source Beutler Lab
Gene Symbol Gcnt3
Ensembl Gene ENSMUSG00000032226
Gene Nameglucosaminyl (N-acetyl) transferase 3, mucin type
Synonyms2010013H22Rik, 2210021I22Rik, 2210401J11Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5407 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location70031496-70038088 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70034189 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 366 (Y366H)
Ref Sequence ENSEMBL: ENSMUSP00000034751 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034751]
Predicted Effect probably benign
Transcript: ENSMUST00000034751
AA Change: Y366H

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000034751
Gene: ENSMUSG00000032226
AA Change: Y366H

DomainStartEndE-ValueType
transmembrane domain 13 30 N/A INTRINSIC
Pfam:Branch 133 401 2.1e-63 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the N-acetylglucosaminyltransferase family. The encoded protein is a beta-6-N-acetylglucosamine-transferase that catalyzes the formation of core 2 and core 4 O-glycans on mucin-type glycoproteins.[provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygote null mice have decreases in core 2 O-glycan structures on cell surfaces, decreased immunoglobulin levels, and disrupted mucosal barrier in the intestines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A C 12: 55,566,196 Y302S probably damaging Het
Arpp21 G T 9: 112,116,753 probably benign Het
Camk1g C T 1: 193,347,372 probably null Het
Cand2 G A 6: 115,785,200 V196I possibly damaging Het
Cdc25b T A 2: 131,193,647 L381Q probably damaging Het
Col17a1 C T 19: 47,666,507 G610E probably damaging Het
Col19a1 C T 1: 24,303,494 E797K probably damaging Het
Col3a1 A T 1: 45,346,052 I110L probably benign Het
Col5a2 T A 1: 45,406,280 D506V possibly damaging Het
Crp A T 1: 172,698,109 probably null Het
Esco1 G T 18: 10,574,886 H729N probably damaging Het
Evx2 A G 2: 74,657,826 S217P probably damaging Het
Gabrb1 T C 5: 72,122,021 V303A possibly damaging Het
Gm436 T C 4: 144,670,325 K279R probably benign Het
Gmpr2 A G 14: 55,678,276 T304A possibly damaging Het
Golga3 C T 5: 110,201,990 Q656* probably null Het
Gramd1b T A 9: 40,455,655 M6L probably damaging Het
Kif17 T C 4: 138,298,221 Y945H probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lrrk1 T A 7: 66,270,797 Q1486L probably benign Het
Mboat7 G T 7: 3,691,381 H72N probably damaging Het
Med12l G A 3: 59,258,201 V1447M probably damaging Het
Mrpl3 T C 9: 105,077,095 F333L probably benign Het
Nav3 T C 10: 109,866,935 T246A probably benign Het
Neil3 A T 8: 53,601,019 V325E probably benign Het
Nlrp4g A T 9: 124,349,930 noncoding transcript Het
Olfr148 A T 9: 39,613,695 I43F probably damaging Het
Onecut1 C T 9: 74,889,456 S419F probably damaging Het
Ptp4a1 A T 1: 30,944,963 V58E probably benign Het
Radil C T 5: 142,508,215 R49H probably damaging Het
Ralgapa1 T C 12: 55,676,797 E1648G possibly damaging Het
Rnft2 C T 5: 118,242,502 M13I probably damaging Het
Satb2 A G 1: 56,948,150 L92P probably damaging Het
Scn4a T C 11: 106,320,889 Y1434C probably damaging Het
Setx T A 2: 29,145,474 M657K probably benign Het
Shd A G 17: 55,973,936 E204G probably damaging Het
Shh T A 5: 28,466,580 R62* probably null Het
Slc9a4 A G 1: 40,607,794 T483A probably benign Het
Tbc1d7 A C 13: 43,154,702 S96A probably benign Het
Tfcp2 T C 15: 100,527,874 probably null Het
Tlk2 T A 11: 105,240,375 S182R probably damaging Het
Tppp2 A G 14: 51,919,498 probably null Het
Trim65 T C 11: 116,126,080 T519A probably benign Het
Trio T C 15: 27,844,806 probably null Het
Usf3 G A 16: 44,217,406 V750I probably benign Het
Utrn T A 10: 12,680,625 K1480N probably damaging Het
Vmn1r58 T A 7: 5,410,873 R119S probably benign Het
Xirp2 A G 2: 67,510,969 I1185V probably benign Het
Zc3h7b A G 15: 81,785,891 H654R probably damaging Het
Zfyve16 G T 13: 92,500,284 A1306E probably damaging Het
Other mutations in Gcnt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01415:Gcnt3 APN 9 70034457 missense probably benign 0.20
IGL02617:Gcnt3 APN 9 70034162 missense probably damaging 1.00
IGL02965:Gcnt3 APN 9 70034953 missense probably benign 0.00
IGL03113:Gcnt3 APN 9 70034701 missense probably damaging 1.00
IGL03374:Gcnt3 APN 9 70034413 missense possibly damaging 0.89
PIT4131001:Gcnt3 UTSW 9 70034044 missense possibly damaging 0.80
R0012:Gcnt3 UTSW 9 70034085 missense probably benign 0.04
R0012:Gcnt3 UTSW 9 70034085 missense probably benign 0.04
R1241:Gcnt3 UTSW 9 70034333 missense probably benign 0.01
R1653:Gcnt3 UTSW 9 70035077 missense probably damaging 1.00
R1662:Gcnt3 UTSW 9 70034377 missense probably benign 0.00
R2213:Gcnt3 UTSW 9 70034707 missense probably benign 0.16
R4588:Gcnt3 UTSW 9 70034230 missense probably damaging 1.00
R4927:Gcnt3 UTSW 9 70035182 missense probably damaging 1.00
R5718:Gcnt3 UTSW 9 70034270 missense probably benign 0.00
R6974:Gcnt3 UTSW 9 70034887 missense probably damaging 1.00
R7883:Gcnt3 UTSW 9 70034171 missense probably damaging 0.97
R8215:Gcnt3 UTSW 9 70034173 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCCATAGATGGCTTTGTGAC -3'
(R):5'- CGAGACTTCATTGAACACGTG -3'

Sequencing Primer
(F):5'- TGGCTTTGTGACGTAAATATTCTTC -3'
(R):5'- GTGTTCAGTAACTCAAAAGCCCGG -3'
Posted On2016-09-01