Incidental Mutation 'R0494:Arhgef1'
ID42634
Institutional Source Beutler Lab
Gene Symbol Arhgef1
Ensembl Gene ENSMUSG00000040940
Gene NameRho guanine nucleotide exchange factor (GEF) 1
SynonymsLbcl2, Lsc
MMRRC Submission 038691-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.422) question?
Stock #R0494 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24902912-24926594 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 24919360 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047873] [ENSMUST00000098683] [ENSMUST00000117419] [ENSMUST00000117796] [ENSMUST00000132751] [ENSMUST00000205295] [ENSMUST00000206508]
Predicted Effect probably benign
Transcript: ENSMUST00000047873
SMART Domains Protein: ENSMUSP00000046469
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098683
SMART Domains Protein: ENSMUSP00000096280
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 2.2e-78 PFAM
PDB:3ODW|B 238 384 2e-57 PDB
low complexity region 396 412 N/A INTRINSIC
low complexity region 439 459 N/A INTRINSIC
RhoGEF 478 662 1.87e-63 SMART
PH 706 820 4.68e-5 SMART
low complexity region 904 923 N/A INTRINSIC
coiled coil region 926 949 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117419
SMART Domains Protein: ENSMUSP00000113366
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 1.3e-72 PFAM
low complexity region 380 400 N/A INTRINSIC
RhoGEF 419 603 1.87e-63 SMART
PH 647 761 4.68e-5 SMART
low complexity region 845 864 N/A INTRINSIC
coiled coil region 867 890 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117796
SMART Domains Protein: ENSMUSP00000113771
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
low complexity region 5 13 N/A INTRINSIC
Pfam:RGS-like 40 230 7.3e-73 PFAM
low complexity region 393 409 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
RhoGEF 475 659 1.87e-63 SMART
PH 703 817 4.68e-5 SMART
low complexity region 901 920 N/A INTRINSIC
coiled coil region 923 946 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129928
Predicted Effect probably benign
Transcript: ENSMUST00000132751
SMART Domains Protein: ENSMUSP00000117008
Gene: ENSMUSG00000040940

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 70 89 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 140 160 N/A INTRINSIC
RhoGEF 179 363 1.87e-63 SMART
PH 407 521 4.68e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145783
Predicted Effect probably benign
Transcript: ENSMUST00000205295
Predicted Effect probably benign
Transcript: ENSMUST00000206508
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 97% (109/112)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli that work through G protein coupled receptors. The encoded protein may form complex with G proteins and stimulate Rho-dependent signals. Multiple alternatively spliced transcript variants have been found for this gene, but the full-length nature of some variants has not been defined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in impaired humeral immunity, reduced numbers of marginal zone B (MZB) cells, decreased basal T cell proliferation, and reduced basal motility of lymphocytes but enhanced migration of MZB cells after serum activation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 108 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik G A 5: 9,420,723 probably null Het
Aatf T C 11: 84,511,513 I116V probably benign Het
Abhd18 T C 3: 40,916,688 F94S probably damaging Het
Adam28 T A 14: 68,630,792 probably benign Het
Amn1 A T 6: 149,185,136 probably benign Het
Arhgap32 T C 9: 32,258,903 V993A probably damaging Het
Arhgap33 A T 7: 30,524,496 S703T probably damaging Het
Atg2a A G 19: 6,253,377 Y1083C probably damaging Het
Atp2a3 T C 11: 72,981,905 F760L probably damaging Het
B9d1 A G 11: 61,512,445 probably benign Het
Batf C T 12: 85,686,862 probably benign Het
BC051019 T A 7: 109,717,975 Y170F probably benign Het
Bphl T C 13: 34,037,771 *37Q probably null Het
Cab39l T C 14: 59,499,559 S43P probably damaging Het
Cad A G 5: 31,077,512 probably benign Het
Cct4 T G 11: 22,996,014 S119A probably benign Het
Cd163 G A 6: 124,311,449 V280M probably damaging Het
Cd86 A G 16: 36,618,637 probably benign Het
Cdh23 G A 10: 60,316,596 probably benign Het
Cdhr5 A G 7: 141,272,518 F145S probably damaging Het
Cdt1 T C 8: 122,572,060 S479P possibly damaging Het
Ces2g T C 8: 104,966,567 V372A probably benign Het
Chrna3 T C 9: 55,022,278 D92G probably damaging Het
Cndp1 A G 18: 84,619,533 S359P probably benign Het
Cops4 A G 5: 100,528,662 Q93R probably damaging Het
Dgka G C 10: 128,721,083 probably benign Het
Dmp1 A T 5: 104,212,208 D250V probably damaging Het
Dnajb2 C T 1: 75,239,634 probably benign Het
Dock9 T C 14: 121,662,584 T113A possibly damaging Het
Egln3 T A 12: 54,203,321 I81F probably benign Het
Elovl5 T C 9: 77,960,917 V37A probably benign Het
Esco1 A T 18: 10,594,940 N115K probably benign Het
Fat1 A T 8: 44,950,542 N110I probably damaging Het
Fezf1 T A 6: 23,246,055 K370N probably damaging Het
Galnt18 T A 7: 111,554,564 K284N probably damaging Het
Glt8d1 C A 14: 31,011,623 T355K possibly damaging Het
Gm13083 G T 4: 143,616,156 V278F probably benign Het
Gm17455 G A 10: 60,403,235 R93H possibly damaging Het
Gng8 T A 7: 16,895,288 D46E probably benign Het
Gpx4 T C 10: 80,056,177 probably benign Het
Grk2 A T 19: 4,291,319 N189K probably damaging Het
Grm5 T C 7: 88,130,781 V1143A probably benign Het
Hibch A G 1: 52,902,896 E237G possibly damaging Het
Hipk2 C T 6: 38,729,989 A682T probably benign Het
Hmcn1 G T 1: 150,732,792 probably benign Het
Htt A G 5: 34,821,844 D857G possibly damaging Het
Idh2 C T 7: 80,098,257 A232T probably damaging Het
Igsf8 A G 1: 172,318,698 E421G probably benign Het
Kif26a T A 12: 112,179,471 probably null Het
Klhl26 T C 8: 70,451,601 Y519C probably damaging Het
Lamc1 A C 1: 153,246,936 probably null Het
Mical3 A T 6: 120,959,201 S1455T possibly damaging Het
Mitf G A 6: 97,994,429 G186S probably benign Het
Ms4a15 G A 19: 10,981,358 probably benign Het
Myo5b A G 18: 74,653,967 E481G probably damaging Het
Nanos3 C T 8: 84,176,134 R133Q probably damaging Het
Nbeal2 C A 9: 110,627,187 V1686L probably damaging Het
Nedd4l T G 18: 65,173,021 S335A possibly damaging Het
Nos1 A T 5: 117,905,474 N605Y probably damaging Het
Nyx C A X: 13,487,269 T454K probably benign Het
Olfr666 A G 7: 104,893,271 L119P probably damaging Het
Olfr972 T A 9: 39,873,402 N42K probably damaging Het
Pcdhb12 T A 18: 37,438,095 F765I probably benign Het
Pex3 C T 10: 13,527,788 G330R probably damaging Het
Pfkfb1 T C X: 150,634,613 Y339H probably damaging Het
Pias1 G A 9: 62,887,311 Q26* probably null Het
Pik3cg C A 12: 32,204,546 V481L possibly damaging Het
Plcg2 C T 8: 117,556,104 T108M probably damaging Het
Pon2 G A 6: 5,267,059 probably benign Het
Ppef2 A T 5: 92,253,093 probably benign Het
Ptpn22 A G 3: 103,860,455 K18E probably damaging Het
Pum2 C T 12: 8,721,736 Q360* probably null Het
Rab10 A C 12: 3,252,723 probably null Het
Ranbp2 T G 10: 58,467,432 S809A possibly damaging Het
Rbms2 A G 10: 128,133,670 V348A probably benign Het
Rnf213 A G 11: 119,426,012 E988G possibly damaging Het
Rnf213 A T 11: 119,443,120 M3052L probably damaging Het
Rpl14 C A 9: 120,574,362 probably benign Het
Rplp0 A G 5: 115,559,872 Y13C possibly damaging Het
Ryr1 A G 7: 29,003,793 probably benign Het
Sac3d1 T C 19: 6,118,294 E98G probably damaging Het
Scn10a T A 9: 119,624,100 D1242V probably damaging Het
Scnn1b T C 7: 121,899,458 Y74H probably damaging Het
Serpinb3a C T 1: 107,047,482 W198* probably null Het
Sf3b4 C A 3: 96,173,701 D108E probably damaging Het
Shprh T C 10: 11,157,191 V307A probably damaging Het
Slc2a2 A G 3: 28,727,277 D458G probably benign Het
Spata5 G C 3: 37,432,163 D345H possibly damaging Het
Strc T C 2: 121,379,533 D103G probably damaging Het
Synrg T C 11: 84,019,543 I923T probably benign Het
Tango6 G T 8: 106,735,682 probably benign Het
Tas2r106 A G 6: 131,678,576 L104P probably damaging Het
Tat C T 8: 109,991,684 P67L probably damaging Het
Tln2 A C 9: 67,355,197 S593A probably benign Het
Tmem94 A G 11: 115,794,781 probably null Het
Tppp3 G A 8: 105,468,172 A109V probably benign Het
Trank1 T C 9: 111,391,293 F2366S probably benign Het
Trpc5 T A X: 144,481,396 Y155F probably damaging Het
Trpv1 A G 11: 73,260,442 T451A probably benign Het
Ttc9 C A 12: 81,631,649 A82E probably damaging Het
Ttll11 T A 2: 35,944,874 N180I probably damaging Het
Ttn T C 2: 76,736,399 N28050S possibly damaging Het
Vmn2r73 G T 7: 85,872,932 H66Q probably benign Het
Vmn2r92 C T 17: 18,167,957 A408V probably damaging Het
Wnt3 G A 11: 103,812,315 C208Y probably damaging Het
Zfp521 C A 18: 13,845,268 C696F probably damaging Het
Zfp521 T C 18: 13,846,870 D162G probably damaging Het
Zfp869 A T 8: 69,706,404 H506Q probably damaging Het
Other mutations in Arhgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Arhgef1 APN 7 24908359 missense possibly damaging 0.93
IGL00901:Arhgef1 APN 7 24912693 missense probably damaging 1.00
IGL01139:Arhgef1 APN 7 24925951 unclassified probably benign
IGL01479:Arhgef1 APN 7 24912603 missense probably benign 0.01
IGL01935:Arhgef1 APN 7 24921882 missense probably damaging 1.00
IGL01944:Arhgef1 APN 7 24925783 critical splice acceptor site probably null
IGL02032:Arhgef1 APN 7 24923371 missense probably benign 0.23
IGL02059:Arhgef1 APN 7 24912552 splice site probably benign
IGL02202:Arhgef1 APN 7 24913429 nonsense probably null
IGL02324:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL02328:Arhgef1 APN 7 24923815 missense probably damaging 1.00
IGL03027:Arhgef1 APN 7 24923732 missense probably damaging 0.98
IGL03227:Arhgef1 APN 7 24922851 missense probably damaging 1.00
IGL03404:Arhgef1 APN 7 24916843 missense probably benign 0.07
R0082:Arhgef1 UTSW 7 24912605 nonsense probably null
R0277:Arhgef1 UTSW 7 24923799 unclassified probably benign
R0336:Arhgef1 UTSW 7 24921957 missense possibly damaging 0.77
R0668:Arhgef1 UTSW 7 24907920 missense possibly damaging 0.63
R1520:Arhgef1 UTSW 7 24919704 missense probably damaging 1.00
R1531:Arhgef1 UTSW 7 24924998 missense probably damaging 0.99
R1656:Arhgef1 UTSW 7 24913632 missense probably damaging 1.00
R2979:Arhgef1 UTSW 7 24907751 missense unknown
R3855:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R3856:Arhgef1 UTSW 7 24919272 missense probably damaging 1.00
R4080:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4081:Arhgef1 UTSW 7 24925846 missense probably damaging 0.96
R4583:Arhgef1 UTSW 7 24912571 missense probably benign 0.09
R4750:Arhgef1 UTSW 7 24918576 intron probably benign
R4914:Arhgef1 UTSW 7 24923839 missense probably damaging 1.00
R5255:Arhgef1 UTSW 7 24925022 missense probably damaging 1.00
R5275:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5295:Arhgef1 UTSW 7 24919352 critical splice donor site probably null
R5430:Arhgef1 UTSW 7 24912307 splice site probably null
R5604:Arhgef1 UTSW 7 24912785 missense probably benign 0.09
R6150:Arhgef1 UTSW 7 24919357 splice site probably null
R6151:Arhgef1 UTSW 7 24917942 missense probably benign 0.00
R6788:Arhgef1 UTSW 7 24919780 splice site probably null
R6943:Arhgef1 UTSW 7 24923731 missense probably benign 0.01
R6988:Arhgef1 UTSW 7 24916923 missense probably benign 0.04
R7422:Arhgef1 UTSW 7 24916036 missense probably benign 0.00
R7701:Arhgef1 UTSW 7 24912578 missense probably benign 0.01
R7706:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7707:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7708:Arhgef1 UTSW 7 24916881 missense probably damaging 1.00
R7995:Arhgef1 UTSW 7 24919216 missense probably damaging 0.99
R8029:Arhgef1 UTSW 7 24919738 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTTTTGATCTGCCCACCACAGTTC -3'
(R):5'- TGGCCTTGACATTTGACGCCTC -3'

Sequencing Primer
(F):5'- gtctgtcctgtctgtcctg -3'
(R):5'- CTCCCCAGGTCTCTAGACTG -3'
Posted On2013-05-23