Incidental Mutation 'R5407:Scn4a'
ID426342
Institutional Source Beutler Lab
Gene Symbol Scn4a
Ensembl Gene ENSMUSG00000001027
Gene Namesodium channel, voltage-gated, type IV, alpha
SynonymsSkM1, mH2, Nav1.4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5407 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location106318592-106353288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106320889 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 1434 (Y1434C)
Ref Sequence ENSEMBL: ENSMUSP00000021056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021056]
Predicted Effect probably damaging
Transcript: ENSMUST00000021056
AA Change: Y1434C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021056
Gene: ENSMUSG00000001027
AA Change: Y1434C

DomainStartEndE-ValueType
Pfam:Ion_trans 130 452 1.1e-80 PFAM
low complexity region 473 491 N/A INTRINSIC
Pfam:Ion_trans 571 805 4.2e-56 PFAM
Pfam:Na_trans_assoc 810 1020 3.2e-59 PFAM
Pfam:Ion_trans 1024 1299 1.4e-64 PFAM
Pfam:Ion_trans 1346 1603 6.1e-55 PFAM
Pfam:PKD_channel 1441 1598 1.4e-6 PFAM
IQ 1720 1742 2.5e-2 SMART
low complexity region 1815 1827 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with 24 transmembrane domains and one or more regulatory beta subunits. They are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. It is expressed in skeletal muscle, and mutations in this gene have been linked to several myotonia and periodic paralysis disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice heterozygous or homozygous for a knock-in allele develop myotonia, increased myofiber damage, K+-sensitive paralysis and susceptibility to delayed weakness during recovery from fatigue. Homozygotes show perinatal lethality, low survival rate, unusual hind-limb clasping and reduced body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A C 12: 55,566,196 Y302S probably damaging Het
Arpp21 G T 9: 112,116,753 probably benign Het
Camk1g C T 1: 193,347,372 probably null Het
Cand2 G A 6: 115,785,200 V196I possibly damaging Het
Cdc25b T A 2: 131,193,647 L381Q probably damaging Het
Col17a1 C T 19: 47,666,507 G610E probably damaging Het
Col19a1 C T 1: 24,303,494 E797K probably damaging Het
Col3a1 A T 1: 45,346,052 I110L probably benign Het
Col5a2 T A 1: 45,406,280 D506V possibly damaging Het
Crp A T 1: 172,698,109 probably null Het
Esco1 G T 18: 10,574,886 H729N probably damaging Het
Evx2 A G 2: 74,657,826 S217P probably damaging Het
Gabrb1 T C 5: 72,122,021 V303A possibly damaging Het
Gcnt3 A G 9: 70,034,189 Y366H probably benign Het
Gm436 T C 4: 144,670,325 K279R probably benign Het
Gmpr2 A G 14: 55,678,276 T304A possibly damaging Het
Golga3 C T 5: 110,201,990 Q656* probably null Het
Gramd1b T A 9: 40,455,655 M6L probably damaging Het
Kif17 T C 4: 138,298,221 Y945H probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lrrk1 T A 7: 66,270,797 Q1486L probably benign Het
Mboat7 G T 7: 3,691,381 H72N probably damaging Het
Med12l G A 3: 59,258,201 V1447M probably damaging Het
Mrpl3 T C 9: 105,077,095 F333L probably benign Het
Nav3 T C 10: 109,866,935 T246A probably benign Het
Neil3 A T 8: 53,601,019 V325E probably benign Het
Nlrp4g A T 9: 124,349,930 noncoding transcript Het
Olfr148 A T 9: 39,613,695 I43F probably damaging Het
Onecut1 C T 9: 74,889,456 S419F probably damaging Het
Ptp4a1 A T 1: 30,944,963 V58E probably benign Het
Radil C T 5: 142,508,215 R49H probably damaging Het
Ralgapa1 T C 12: 55,676,797 E1648G possibly damaging Het
Rnft2 C T 5: 118,242,502 M13I probably damaging Het
Satb2 A G 1: 56,948,150 L92P probably damaging Het
Setx T A 2: 29,145,474 M657K probably benign Het
Shd A G 17: 55,973,936 E204G probably damaging Het
Shh T A 5: 28,466,580 R62* probably null Het
Slc9a4 A G 1: 40,607,794 T483A probably benign Het
Tbc1d7 A C 13: 43,154,702 S96A probably benign Het
Tfcp2 T C 15: 100,527,874 probably null Het
Tlk2 T A 11: 105,240,375 S182R probably damaging Het
Tppp2 A G 14: 51,919,498 probably null Het
Trim65 T C 11: 116,126,080 T519A probably benign Het
Trio T C 15: 27,844,806 probably null Het
Usf3 G A 16: 44,217,406 V750I probably benign Het
Utrn T A 10: 12,680,625 K1480N probably damaging Het
Vmn1r58 T A 7: 5,410,873 R119S probably benign Het
Xirp2 A G 2: 67,510,969 I1185V probably benign Het
Zc3h7b A G 15: 81,785,891 H654R probably damaging Het
Zfyve16 G T 13: 92,500,284 A1306E probably damaging Het
Other mutations in Scn4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Scn4a APN 11 106319919 missense probably benign
IGL00846:Scn4a APN 11 106328118 missense probably benign 0.03
IGL01063:Scn4a APN 11 106330364 missense possibly damaging 0.91
IGL01450:Scn4a APN 11 106324661 missense probably damaging 0.99
IGL01922:Scn4a APN 11 106339152 critical splice donor site probably null
IGL02589:Scn4a APN 11 106328132 missense probably benign 0.08
IGL03171:Scn4a APN 11 106345592 missense probably benign 0.01
IGL03338:Scn4a APN 11 106320845 missense probably damaging 1.00
BB004:Scn4a UTSW 11 106342383 missense probably damaging 1.00
BB014:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0013:Scn4a UTSW 11 106348405 splice site probably benign
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0025:Scn4a UTSW 11 106324560 missense probably benign 0.39
R0050:Scn4a UTSW 11 106320856 missense probably damaging 1.00
R0113:Scn4a UTSW 11 106345436 missense probably benign 0.00
R0193:Scn4a UTSW 11 106320538 nonsense probably null
R0410:Scn4a UTSW 11 106323949 missense probably damaging 1.00
R0512:Scn4a UTSW 11 106345677 missense probably damaging 1.00
R0532:Scn4a UTSW 11 106330400 missense probably benign 0.45
R1112:Scn4a UTSW 11 106320466 missense probably damaging 1.00
R1279:Scn4a UTSW 11 106335682 missense probably damaging 1.00
R1564:Scn4a UTSW 11 106345541 missense probably benign
R1712:Scn4a UTSW 11 106339354 missense probably damaging 1.00
R1712:Scn4a UTSW 11 106345547 missense probably benign 0.20
R1721:Scn4a UTSW 11 106320820 missense probably benign 0.31
R1900:Scn4a UTSW 11 106327533 missense probably damaging 1.00
R2057:Scn4a UTSW 11 106335724 missense probably damaging 0.97
R2209:Scn4a UTSW 11 106339225 missense probably damaging 1.00
R3416:Scn4a UTSW 11 106330413 missense probably benign 0.00
R3788:Scn4a UTSW 11 106344274 missense probably damaging 0.96
R3853:Scn4a UTSW 11 106320106 missense possibly damaging 0.94
R3861:Scn4a UTSW 11 106326124 splice site probably benign
R3912:Scn4a UTSW 11 106320716 missense probably damaging 1.00
R3983:Scn4a UTSW 11 106347818 missense probably damaging 1.00
R4036:Scn4a UTSW 11 106322057 missense possibly damaging 0.75
R4358:Scn4a UTSW 11 106348857 splice site probably null
R4556:Scn4a UTSW 11 106320446 missense probably benign 0.32
R4677:Scn4a UTSW 11 106323962 missense probably damaging 1.00
R4863:Scn4a UTSW 11 106320002 missense probably damaging 1.00
R4924:Scn4a UTSW 11 106320088 missense possibly damaging 0.83
R5081:Scn4a UTSW 11 106348727 missense probably damaging 0.99
R5298:Scn4a UTSW 11 106339386 missense probably damaging 1.00
R5634:Scn4a UTSW 11 106330004 missense probably benign
R6381:Scn4a UTSW 11 106320311 missense probably damaging 1.00
R6468:Scn4a UTSW 11 106345676 missense probably damaging 1.00
R6489:Scn4a UTSW 11 106349180 missense probably benign 0.26
R6549:Scn4a UTSW 11 106343965 missense probably damaging 1.00
R6606:Scn4a UTSW 11 106328073 missense probably benign 0.39
R7037:Scn4a UTSW 11 106320900 missense probably damaging 0.98
R7064:Scn4a UTSW 11 106322157 missense possibly damaging 0.93
R7182:Scn4a UTSW 11 106330308 missense probably benign 0.21
R7194:Scn4a UTSW 11 106324236 missense probably benign 0.32
R7531:Scn4a UTSW 11 106348697 splice site probably null
R7552:Scn4a UTSW 11 106349169 missense probably benign 0.22
R7570:Scn4a UTSW 11 106320473 missense possibly damaging 0.54
R7635:Scn4a UTSW 11 106324632 missense probably damaging 1.00
R7823:Scn4a UTSW 11 106342508 missense probably damaging 1.00
R7832:Scn4a UTSW 11 106322015 missense probably benign 0.01
R7927:Scn4a UTSW 11 106342383 missense probably damaging 1.00
R8122:Scn4a UTSW 11 106330331 missense probably benign 0.02
R8131:Scn4a UTSW 11 106341541 missense probably benign
X0012:Scn4a UTSW 11 106330061 missense probably damaging 1.00
X0065:Scn4a UTSW 11 106322178 missense probably damaging 0.98
Z1176:Scn4a UTSW 11 106321908 missense probably null 0.29
Z1176:Scn4a UTSW 11 106341529 missense probably benign 0.26
Z1176:Scn4a UTSW 11 106341530 missense probably damaging 0.97
Z1177:Scn4a UTSW 11 106330208 missense not run
Z1177:Scn4a UTSW 11 106341542 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGAACATGTCGTCGATGCCC -3'
(R):5'- TGTAACCGTCAAGACACCG -3'

Sequencing Primer
(F):5'- TCTTGACGTAGGCGAAGTTAGAC -3'
(R):5'- GTAACCGTCAAGACACCGCAATC -3'
Posted On2016-09-01