Incidental Mutation 'R5407:Gmpr2'
ID426350
Institutional Source Beutler Lab
Gene Symbol Gmpr2
Ensembl Gene ENSMUSG00000002326
Gene Nameguanosine monophosphate reductase 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.296) question?
Stock #R5407 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location55671941-55679200 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55678276 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 304 (T304A)
Ref Sequence ENSEMBL: ENSMUSP00000002397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002397] [ENSMUST00000007733] [ENSMUST00000226314] [ENSMUST00000227178] [ENSMUST00000227842] [ENSMUST00000227873] [ENSMUST00000227914]
Predicted Effect possibly damaging
Transcript: ENSMUST00000002397
AA Change: T304A

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000002397
Gene: ENSMUSG00000002326
AA Change: T304A

DomainStartEndE-ValueType
IMPDH 8 347 7.5e-147 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000007733
SMART Domains Protein: ENSMUSP00000007733
Gene: ENSMUSG00000007589

DomainStartEndE-ValueType
Pfam:TINF2_N 20 159 1.8e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226314
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226641
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226787
Predicted Effect probably benign
Transcript: ENSMUST00000226819
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227106
Predicted Effect probably benign
Transcript: ENSMUST00000227178
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227696
Predicted Effect probably benign
Transcript: ENSMUST00000227842
Predicted Effect probably benign
Transcript: ENSMUST00000227873
Predicted Effect probably benign
Transcript: ENSMUST00000227914
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228264
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228683
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldoart2 A C 12: 55,566,196 Y302S probably damaging Het
Arpp21 G T 9: 112,116,753 probably benign Het
Camk1g C T 1: 193,347,372 probably null Het
Cand2 G A 6: 115,785,200 V196I possibly damaging Het
Cdc25b T A 2: 131,193,647 L381Q probably damaging Het
Col17a1 C T 19: 47,666,507 G610E probably damaging Het
Col19a1 C T 1: 24,303,494 E797K probably damaging Het
Col3a1 A T 1: 45,346,052 I110L probably benign Het
Col5a2 T A 1: 45,406,280 D506V possibly damaging Het
Crp A T 1: 172,698,109 probably null Het
Esco1 G T 18: 10,574,886 H729N probably damaging Het
Evx2 A G 2: 74,657,826 S217P probably damaging Het
Gabrb1 T C 5: 72,122,021 V303A possibly damaging Het
Gcnt3 A G 9: 70,034,189 Y366H probably benign Het
Gm436 T C 4: 144,670,325 K279R probably benign Het
Golga3 C T 5: 110,201,990 Q656* probably null Het
Gramd1b T A 9: 40,455,655 M6L probably damaging Het
Kif17 T C 4: 138,298,221 Y945H probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lrrk1 T A 7: 66,270,797 Q1486L probably benign Het
Mboat7 G T 7: 3,691,381 H72N probably damaging Het
Med12l G A 3: 59,258,201 V1447M probably damaging Het
Mrpl3 T C 9: 105,077,095 F333L probably benign Het
Nav3 T C 10: 109,866,935 T246A probably benign Het
Neil3 A T 8: 53,601,019 V325E probably benign Het
Nlrp4g A T 9: 124,349,930 noncoding transcript Het
Olfr148 A T 9: 39,613,695 I43F probably damaging Het
Onecut1 C T 9: 74,889,456 S419F probably damaging Het
Ptp4a1 A T 1: 30,944,963 V58E probably benign Het
Radil C T 5: 142,508,215 R49H probably damaging Het
Ralgapa1 T C 12: 55,676,797 E1648G possibly damaging Het
Rnft2 C T 5: 118,242,502 M13I probably damaging Het
Satb2 A G 1: 56,948,150 L92P probably damaging Het
Scn4a T C 11: 106,320,889 Y1434C probably damaging Het
Setx T A 2: 29,145,474 M657K probably benign Het
Shd A G 17: 55,973,936 E204G probably damaging Het
Shh T A 5: 28,466,580 R62* probably null Het
Slc9a4 A G 1: 40,607,794 T483A probably benign Het
Tbc1d7 A C 13: 43,154,702 S96A probably benign Het
Tfcp2 T C 15: 100,527,874 probably null Het
Tlk2 T A 11: 105,240,375 S182R probably damaging Het
Tppp2 A G 14: 51,919,498 probably null Het
Trim65 T C 11: 116,126,080 T519A probably benign Het
Trio T C 15: 27,844,806 probably null Het
Usf3 G A 16: 44,217,406 V750I probably benign Het
Utrn T A 10: 12,680,625 K1480N probably damaging Het
Vmn1r58 T A 7: 5,410,873 R119S probably benign Het
Xirp2 A G 2: 67,510,969 I1185V probably benign Het
Zc3h7b A G 15: 81,785,891 H654R probably damaging Het
Zfyve16 G T 13: 92,500,284 A1306E probably damaging Het
Other mutations in Gmpr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Gmpr2 APN 14 55675714 missense probably damaging 0.98
IGL00949:Gmpr2 APN 14 55676750 splice site probably benign
IGL02348:Gmpr2 APN 14 55678301 missense probably damaging 1.00
R0092:Gmpr2 UTSW 14 55677945 missense probably benign 0.36
R0197:Gmpr2 UTSW 14 55672735 missense possibly damaging 0.83
R0323:Gmpr2 UTSW 14 55672746 missense probably damaging 0.99
R0594:Gmpr2 UTSW 14 55677988 missense probably damaging 1.00
R1366:Gmpr2 UTSW 14 55676743 splice site probably benign
R2904:Gmpr2 UTSW 14 55672758 missense probably damaging 1.00
R4996:Gmpr2 UTSW 14 55676795 missense probably damaging 0.99
R5695:Gmpr2 UTSW 14 55677234 missense possibly damaging 0.77
R6721:Gmpr2 UTSW 14 55672734 missense probably damaging 1.00
R7414:Gmpr2 UTSW 14 55672802 critical splice donor site probably null
R7623:Gmpr2 UTSW 14 55673034 missense probably damaging 0.99
X0025:Gmpr2 UTSW 14 55675390 missense probably benign
Z1176:Gmpr2 UTSW 14 55672743 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- AAGGCTAGCACCTGAATGTTC -3'
(R):5'- TGCTGCCTCAGGAAAGTAGG -3'

Sequencing Primer
(F):5'- TCCTGGTGACGACTCTATGAAAG -3'
(R):5'- CCTCAGGAAAGTAGGCTTCTTG -3'
Posted On2016-09-01