Incidental Mutation 'R5408:Aldh2'
ID426380
Institutional Source Beutler Lab
Gene Symbol Aldh2
Ensembl Gene ENSMUSG00000029455
Gene Namealdehyde dehydrogenase 2, mitochondrial
SynonymsAhd5, Ahd-5
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location121566027-121593824 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 121570557 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000031411] [ENSMUST00000129753] [ENSMUST00000199369]
Predicted Effect probably benign
Transcript: ENSMUST00000031411
SMART Domains Protein: ENSMUSP00000031411
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 510 2.9e-185 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000129753
SMART Domains Protein: ENSMUSP00000142906
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
low complexity region 10 26 N/A INTRINSIC
Pfam:Aldedh 47 471 1e-170 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133033
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196694
Predicted Effect probably benign
Transcript: ENSMUST00000199369
SMART Domains Protein: ENSMUSP00000143261
Gene: ENSMUSG00000029455

DomainStartEndE-ValueType
Pfam:Aldedh 1 129 4.2e-43 PFAM
Pfam:Aldedh 125 220 3.6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200541
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein belongs to the aldehyde dehydrogenase family of proteins. Aldehyde dehydrogenase is the second enzyme of the major oxidative pathway of alcohol metabolism. Two major liver isoforms of aldehyde dehydrogenase, cytosolic and mitochondrial, can be distinguished by their electrophoretic mobilities, kinetic properties, and subcellular localizations. Most Caucasians have two major isozymes, while approximately 50% of East Asians have the cytosolic isozyme but not the mitochondrial isozyme. A remarkably higher frequency of acute alcohol intoxication among East Asians than among Caucasians could be related to the absence of a catalytically active form of the mitochondrial isozyme. The increased exposure to acetaldehyde in individuals with the catalytically inactive form may also confer greater susceptibility to many types of cancer. This gene encodes a mitochondrial isoform, which has a low Km for acetaldehydes, and is localized in mitochondrial matrix. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygous mutation of this gene results in the absence of oxidation activity in the mitochondria. Mice homozygous for a different allele exhibit decreased litter size. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Aldh2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01813:Aldh2 APN 5 121572073 missense probably benign 0.00
IGL02145:Aldh2 APN 5 121567993 makesense probably null
IGL02352:Aldh2 APN 5 121575897 missense probably null 1.00
IGL02359:Aldh2 APN 5 121575897 missense probably null 1.00
IGL02473:Aldh2 APN 5 121572078 missense probably damaging 1.00
IGL02818:Aldh2 APN 5 121575125 missense probably benign
IGL03182:Aldh2 APN 5 121580724 unclassified probably benign
IGL03324:Aldh2 APN 5 121575125 missense probably benign
Flushed UTSW 5 121572816 nonsense probably null
R0595:Aldh2 UTSW 5 121573500 missense probably damaging 0.99
R0595:Aldh2 UTSW 5 121573501 missense probably damaging 0.97
R1697:Aldh2 UTSW 5 121578341 critical splice donor site probably null
R1992:Aldh2 UTSW 5 121575963 missense possibly damaging 0.93
R2174:Aldh2 UTSW 5 121572668 intron probably benign
R4786:Aldh2 UTSW 5 121572824 missense probably benign 0.21
R4793:Aldh2 UTSW 5 121568979 missense probably damaging 0.99
R5934:Aldh2 UTSW 5 121579615 missense probably benign
R6266:Aldh2 UTSW 5 121568934 missense probably damaging 0.97
R6294:Aldh2 UTSW 5 121572816 nonsense probably null
R6792:Aldh2 UTSW 5 121580649 missense probably damaging 0.98
X0009:Aldh2 UTSW 5 121572774 missense possibly damaging 0.94
X0027:Aldh2 UTSW 5 121593462 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCTTCTCTGGACACAGTCAC -3'
(R):5'- CAAGACCATCGAGGAGGTTG -3'

Sequencing Primer
(F):5'- CAGAGGGTACTGATCTCTATGCAGC -3'
(R):5'- CCATCGAGGAGGTTGTGGGG -3'
Posted On2016-09-01