Incidental Mutation 'R5408:Olfr504'
ID426391
Institutional Source Beutler Lab
Gene Symbol Olfr504
Ensembl Gene ENSMUSG00000060105
Gene Nameolfactory receptor 504
SynonymsGA_x6K02T2PBJ9-10895499-10894543, MOR40-15, MOR40-7P
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location108564836-108565793 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 108565169 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 209 (A209T)
Ref Sequence ENSEMBL: ENSMUSP00000075025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075595]
Predicted Effect probably damaging
Transcript: ENSMUST00000075595
AA Change: A209T

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000075025
Gene: ENSMUSG00000060105
AA Change: A209T

DomainStartEndE-ValueType
Pfam:7tm_4 37 314 3.9e-70 PFAM
Pfam:7TM_GPCR_Srsx 40 311 5.1e-10 PFAM
Pfam:7tm_1 47 296 3.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207199
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207240
Meta Mutation Damage Score 0.4861 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Olfr504
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Olfr504 APN 7 108565202 missense probably benign 0.02
IGL01447:Olfr504 APN 7 108565009 missense possibly damaging 0.75
IGL01845:Olfr504 APN 7 108565136 missense possibly damaging 0.76
IGL02110:Olfr504 APN 7 108565079 missense probably damaging 1.00
IGL03196:Olfr504 APN 7 108564854 missense probably benign
R0282:Olfr504 UTSW 7 108565477 missense probably damaging 1.00
R0359:Olfr504 UTSW 7 108565514 missense probably benign 0.01
R0514:Olfr504 UTSW 7 108565672 missense probably damaging 1.00
R0727:Olfr504 UTSW 7 108565108 missense probably benign 0.00
R0744:Olfr504 UTSW 7 108564998 missense possibly damaging 0.57
R0836:Olfr504 UTSW 7 108564998 missense possibly damaging 0.57
R0840:Olfr504 UTSW 7 108565616 missense probably benign 0.00
R0883:Olfr504 UTSW 7 108565276 missense probably benign 0.01
R1750:Olfr504 UTSW 7 108565357 nonsense probably null
R1827:Olfr504 UTSW 7 108565075 missense probably benign 0.35
R1933:Olfr504 UTSW 7 108565523 missense possibly damaging 0.57
R3004:Olfr504 UTSW 7 108564944 missense probably benign 0.42
R3766:Olfr504 UTSW 7 108565195 missense probably benign 0.00
R5179:Olfr504 UTSW 7 108565226 missense probably benign
R5493:Olfr504 UTSW 7 108565567 missense probably benign 0.24
R5569:Olfr504 UTSW 7 108565565 missense probably benign 0.01
R6520:Olfr504 UTSW 7 108564839 makesense probably null
R6798:Olfr504 UTSW 7 108565760 nonsense probably null
R6803:Olfr504 UTSW 7 108565413 missense probably damaging 1.00
R7242:Olfr504 UTSW 7 108565712 missense probably benign 0.03
R7559:Olfr504 UTSW 7 108565556 missense probably damaging 0.99
R7644:Olfr504 UTSW 7 108565442 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- ATCACATTGAGCAAAACTGGGATC -3'
(R):5'- CCACACTGTTTATGGTGCTGAG -3'

Sequencing Primer
(F):5'- CCTTGGTCTCTGACAAGTGAGTTAC -3'
(R):5'- CACACTGTTTATGGTGCTGAGAAATG -3'
Posted On2016-09-01