Incidental Mutation 'R5408:Slc7a2'
ID426394
Institutional Source Beutler Lab
Gene Symbol Slc7a2
Ensembl Gene ENSMUSG00000031596
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 2
SynonymsTea, Cat2, Atrc2
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location40862396-40922308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 40915005 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 602 (R602K)
Ref Sequence ENSEMBL: ENSMUSP00000112848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057784] [ENSMUST00000098816] [ENSMUST00000117077] [ENSMUST00000118432]
Predicted Effect probably damaging
Transcript: ENSMUST00000057784
AA Change: R585K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058866
Gene: ENSMUSG00000031596
AA Change: R585K

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 450 1.4e-55 PFAM
Pfam:AA_permease 38 442 9.7e-38 PFAM
transmembrane domain 492 514 N/A INTRINSIC
transmembrane domain 524 543 N/A INTRINSIC
Pfam:AA_permease_C 555 605 4.2e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098816
AA Change: R586K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096414
Gene: ENSMUSG00000031596
AA Change: R586K

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 451 8.9e-54 PFAM
Pfam:AA_permease 38 443 5.8e-35 PFAM
transmembrane domain 493 515 N/A INTRINSIC
transmembrane domain 525 544 N/A INTRINSIC
Pfam:AA_permease_C 556 606 4.1e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000117077
AA Change: R586K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113729
Gene: ENSMUSG00000031596
AA Change: R586K

DomainStartEndE-ValueType
Pfam:AA_permease_2 34 454 2e-52 PFAM
Pfam:AA_permease 38 440 4.8e-33 PFAM
transmembrane domain 493 515 N/A INTRINSIC
transmembrane domain 525 544 N/A INTRINSIC
Pfam:AA_permease_C 556 606 3e-28 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000118432
AA Change: R602K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112848
Gene: ENSMUSG00000031596
AA Change: R602K

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:AA_permease_2 51 469 5.1e-54 PFAM
Pfam:AA_permease 55 456 5.1e-36 PFAM
transmembrane domain 509 531 N/A INTRINSIC
transmembrane domain 541 560 N/A INTRINSIC
Pfam:AA_permease_C 572 622 2.5e-28 PFAM
Meta Mutation Damage Score 0.282 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cationic amino acid transporter and a member of the APC (amino acid-polyamine-organocation) family of transporters. The encoded membrane protein is responsible for the cellular uptake of arginine, lysine and ornithine. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a marked reduction of nitric oxide production by cytokine-activated macrophages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Slc7a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Slc7a2 APN 8 40905622 missense possibly damaging 0.57
IGL00948:Slc7a2 APN 8 40912524 missense probably benign 0.04
IGL01565:Slc7a2 APN 8 40899238 missense possibly damaging 0.94
IGL01590:Slc7a2 APN 8 40914100 missense probably damaging 1.00
IGL01939:Slc7a2 APN 8 40914083 missense possibly damaging 0.93
IGL02043:Slc7a2 APN 8 40911058 missense probably benign 0.35
IGL02101:Slc7a2 APN 8 40902594 missense probably benign 0.07
IGL02238:Slc7a2 APN 8 40908156 missense probably benign
IGL02385:Slc7a2 APN 8 40899011 missense probably damaging 0.98
IGL02562:Slc7a2 APN 8 40915020 missense probably damaging 1.00
IGL02962:Slc7a2 APN 8 40905584 missense probably damaging 0.98
IGL03268:Slc7a2 APN 8 40912517 missense probably benign 0.00
IGL03285:Slc7a2 APN 8 40914993 missense possibly damaging 0.50
IGL03345:Slc7a2 APN 8 40916493 missense probably benign 0.25
IGL03375:Slc7a2 APN 8 40916373 missense probably damaging 1.00
R0014:Slc7a2 UTSW 8 40911028 missense probably damaging 1.00
R0014:Slc7a2 UTSW 8 40911028 missense probably damaging 1.00
R0437:Slc7a2 UTSW 8 40904526 missense probably damaging 1.00
R0624:Slc7a2 UTSW 8 40908531 missense probably benign 0.34
R1406:Slc7a2 UTSW 8 40905585 missense probably damaging 1.00
R1406:Slc7a2 UTSW 8 40905585 missense probably damaging 1.00
R1908:Slc7a2 UTSW 8 40916497 missense probably benign
R1959:Slc7a2 UTSW 8 40914965 missense probably damaging 0.97
R2251:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R2252:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R2253:Slc7a2 UTSW 8 40905621 missense probably benign 0.19
R3498:Slc7a2 UTSW 8 40912530 missense probably benign 0.11
R3899:Slc7a2 UTSW 8 40905553 missense possibly damaging 0.93
R4440:Slc7a2 UTSW 8 40902649 missense probably benign
R4785:Slc7a2 UTSW 8 40911058 missense probably benign 0.18
R4788:Slc7a2 UTSW 8 40913986 missense probably benign
R4826:Slc7a2 UTSW 8 40911046 missense probably damaging 1.00
R4996:Slc7a2 UTSW 8 40912562 nonsense probably null
R5249:Slc7a2 UTSW 8 40908093 missense possibly damaging 0.77
R5314:Slc7a2 UTSW 8 40915030 critical splice donor site probably null
R5537:Slc7a2 UTSW 8 40913986 missense probably benign 0.10
R6116:Slc7a2 UTSW 8 40900169 missense probably damaging 0.98
R7139:Slc7a2 UTSW 8 40915013 missense probably benign 0.01
R7389:Slc7a2 UTSW 8 40912515 missense probably benign
R7451:Slc7a2 UTSW 8 40912649 missense probably damaging 0.99
X0062:Slc7a2 UTSW 8 40914963 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCAGTGAACTCTCAGCTAC -3'
(R):5'- AATGCTGAGATGTTCTTGGAAGTC -3'

Sequencing Primer
(F):5'- CCTACAGAACTGGTGCTTAGTGAC -3'
(R):5'- CTTGGAAGTCGGATTGGAAGG -3'
Posted On2016-09-01