Incidental Mutation 'R5408:Cdh3'
ID426397
Institutional Source Beutler Lab
Gene Symbol Cdh3
Ensembl Gene ENSMUSG00000061048
Gene Namecadherin 3
SynonymsPcad, P-cadherin, Cadp
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location106510891-106557297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106536637 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 106 (I106T)
Ref Sequence ENSEMBL: ENSMUSP00000079613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080797]
PDB Structure
Crystal structure of mouse P-cadherin extracellular domains EC1-EC2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000080797
AA Change: I106T

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079613
Gene: ENSMUSG00000061048
AA Change: I106T

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 122 205 7.57e-11 SMART
CA 229 318 1.68e-26 SMART
CA 341 431 4.21e-18 SMART
CA 454 538 1.28e-22 SMART
Pfam:Cadherin_C 673 818 3.9e-46 PFAM
Meta Mutation Damage Score 0.3825 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent cell-cell adhesion protein containing five cadherin domains. The encoded protein plays a role in epithelial outgrowth, such as that which occurs during the development of hair follicles and limb buds. Loss of function of the related gene in humans results in ectodermal dysplasia, ectrodactyly, and macular dystrophy and congential hypotrichosis with juvenile macular dystrophy. This gene is located in the vicinity of similar cadherin genes on chromosome 8. The proprotein is further cleaved into a functional chain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutation of this gene results in precocious development of mammary glands in virgin 10-week old females. Aged virgin females (24 weeks) exhibit alveolar hyperplasia, ductal dysplasia, and extensive lymphocyte infiltration of the mammary glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Cdh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Cdh3 APN 8 106555305 missense probably damaging 1.00
IGL01431:Cdh3 APN 8 106547669 missense probably damaging 1.00
IGL01466:Cdh3 APN 8 106536595 missense possibly damaging 0.62
IGL01794:Cdh3 APN 8 106537126 missense possibly damaging 0.78
IGL02100:Cdh3 APN 8 106543690 missense probably benign
IGL02272:Cdh3 APN 8 106547836 splice site probably null
IGL02292:Cdh3 APN 8 106545201 missense probably damaging 0.99
IGL02553:Cdh3 APN 8 106544248 nonsense probably null
IGL03245:Cdh3 APN 8 106552999 missense probably damaging 1.00
IGL03376:Cdh3 APN 8 106541404 missense probably benign 0.01
PIT4486001:Cdh3 UTSW 8 106541490 missense possibly damaging 0.89
R0143:Cdh3 UTSW 8 106511225 missense probably benign 0.35
R0388:Cdh3 UTSW 8 106539129 missense probably damaging 1.00
R0462:Cdh3 UTSW 8 106555380 missense possibly damaging 0.65
R0526:Cdh3 UTSW 8 106555446 missense possibly damaging 0.69
R0788:Cdh3 UTSW 8 106541415 missense probably benign 0.05
R1495:Cdh3 UTSW 8 106538997 missense probably damaging 1.00
R1653:Cdh3 UTSW 8 106539068 missense probably damaging 1.00
R1806:Cdh3 UTSW 8 106536915 missense probably benign 0.02
R2124:Cdh3 UTSW 8 106552888 missense probably damaging 1.00
R2302:Cdh3 UTSW 8 106545069 missense probably damaging 1.00
R2326:Cdh3 UTSW 8 106511308 missense probably benign
R2508:Cdh3 UTSW 8 106552407 missense probably damaging 1.00
R3625:Cdh3 UTSW 8 106543678 missense probably damaging 0.98
R3767:Cdh3 UTSW 8 106536974 splice site probably null
R4679:Cdh3 UTSW 8 106539856 missense probably damaging 1.00
R4716:Cdh3 UTSW 8 106543888 missense probably benign
R4778:Cdh3 UTSW 8 106543826 missense probably damaging 0.98
R4928:Cdh3 UTSW 8 106536610 missense probably benign 0.15
R5069:Cdh3 UTSW 8 106536826 missense probably benign 0.19
R5101:Cdh3 UTSW 8 106541392 missense possibly damaging 0.60
R5204:Cdh3 UTSW 8 106544239 missense probably benign 0.29
R5309:Cdh3 UTSW 8 106539020 missense probably damaging 0.98
R5343:Cdh3 UTSW 8 106552936 missense probably benign
R6253:Cdh3 UTSW 8 106537063 splice site probably null
R6637:Cdh3 UTSW 8 106511341 missense probably benign
R6639:Cdh3 UTSW 8 106511341 missense probably benign
R7142:Cdh3 UTSW 8 106545228 critical splice donor site probably null
R7371:Cdh3 UTSW 8 106552477 missense probably damaging 1.00
R7397:Cdh3 UTSW 8 106536609 nonsense probably null
R7458:Cdh3 UTSW 8 106537147 missense probably damaging 1.00
R7512:Cdh3 UTSW 8 106539008 nonsense probably null
R7522:Cdh3 UTSW 8 106541373 missense probably damaging 1.00
R7586:Cdh3 UTSW 8 106511343 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCATTCCTCCTGAGAAGAC -3'
(R):5'- GAAAATCTTGGTGCCTCTGTCC -3'

Sequencing Primer
(F):5'- GGCTGGCCTCAAATTGCTACATAG -3'
(R):5'- GTCCTTATTAGATTTGAGCTGGAAAC -3'
Posted On2016-09-01