Incidental Mutation 'R5408:Fam171a2'
ID426411
Institutional Source Beutler Lab
Gene Symbol Fam171a2
Ensembl Gene ENSMUSG00000034685
Gene Namefamily with sequence similarity 171, member A2
Synonyms
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R5408 (G1)
Quality Score152
Status Validated
Chromosome11
Chromosomal Location102436981-102447682 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102437518 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 805 (K805R)
Ref Sequence ENSEMBL: ENSMUSP00000038486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049057] [ENSMUST00000049460] [ENSMUST00000125819] [ENSMUST00000129997]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049057
AA Change: K805R

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000038486
Gene: ENSMUSG00000034685
AA Change: K805R

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:UPF0560 41 820 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049460
SMART Domains Protein: ENSMUSP00000046340
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
GRAN 74 125 1.32e-22 SMART
GRAN 138 190 7.38e-26 SMART
GRAN 220 272 5.76e-28 SMART
GRAN 295 346 1.19e-29 SMART
GRAN 377 427 1.84e-26 SMART
GRAN 455 506 7.1e-28 SMART
GRAN 530 581 1.48e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123500
Predicted Effect probably benign
Transcript: ENSMUST00000125819
SMART Domains Protein: ENSMUSP00000134948
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 42 72 5.03e-4 SMART
GRAN 100 151 7.1e-28 SMART
GRAN 175 226 1.48e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127530
Predicted Effect probably benign
Transcript: ENSMUST00000129997
SMART Domains Protein: ENSMUSP00000135739
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
GRAN 61 112 1.32e-22 SMART
GRAN 125 177 7.38e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135517
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145190
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148580
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152015
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176953
Predicted Effect probably benign
Transcript: ENSMUST00000177428
SMART Domains Protein: ENSMUSP00000134893
Gene: ENSMUSG00000034708

DomainStartEndE-ValueType
GRAN 1 49 8.68e-23 SMART
GRAN 77 128 7.1e-28 SMART
GRAN 152 180 3.98e-2 SMART
low complexity region 244 259 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
Meta Mutation Damage Score 0.1740 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Fam171a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01089:Fam171a2 APN 11 102437848 missense possibly damaging 0.92
IGL01898:Fam171a2 APN 11 102439756 missense possibly damaging 0.88
IGL02477:Fam171a2 APN 11 102440028 missense probably benign 0.00
IGL03272:Fam171a2 APN 11 102444118 missense possibly damaging 0.58
R0102:Fam171a2 UTSW 11 102444113 missense possibly damaging 0.88
R0102:Fam171a2 UTSW 11 102444113 missense possibly damaging 0.88
R0632:Fam171a2 UTSW 11 102437881 missense probably damaging 0.99
R0733:Fam171a2 UTSW 11 102439722 missense possibly damaging 0.83
R1005:Fam171a2 UTSW 11 102440181 missense probably benign 0.05
R1323:Fam171a2 UTSW 11 102444125 missense probably damaging 0.99
R1323:Fam171a2 UTSW 11 102444125 missense probably damaging 0.99
R2425:Fam171a2 UTSW 11 102438361 missense possibly damaging 0.88
R4838:Fam171a2 UTSW 11 102438685 missense possibly damaging 0.88
R4858:Fam171a2 UTSW 11 102440156 missense probably damaging 1.00
R5119:Fam171a2 UTSW 11 102438733 missense probably damaging 0.97
R5384:Fam171a2 UTSW 11 102437867 missense possibly damaging 0.51
R5386:Fam171a2 UTSW 11 102437867 missense possibly damaging 0.51
R5457:Fam171a2 UTSW 11 102437536 missense possibly damaging 0.92
R5732:Fam171a2 UTSW 11 102439981 missense possibly damaging 0.94
R6466:Fam171a2 UTSW 11 102439885 missense probably damaging 1.00
R6931:Fam171a2 UTSW 11 102438434 missense possibly damaging 0.95
R7196:Fam171a2 UTSW 11 102438346 missense probably benign 0.04
R7261:Fam171a2 UTSW 11 102438074 missense probably damaging 0.98
R7295:Fam171a2 UTSW 11 102438238 missense possibly damaging 0.85
R7419:Fam171a2 UTSW 11 102438802 missense possibly damaging 0.95
R7422:Fam171a2 UTSW 11 102438665 missense probably benign 0.29
R7454:Fam171a2 UTSW 11 102439717 missense possibly damaging 0.88
R7606:Fam171a2 UTSW 11 102444176 missense possibly damaging 0.75
R7690:Fam171a2 UTSW 11 102437834 missense probably benign 0.04
R7754:Fam171a2 UTSW 11 102438563 missense probably benign 0.00
R8060:Fam171a2 UTSW 11 102438610 missense possibly damaging 0.88
Z1176:Fam171a2 UTSW 11 102447446 missense unknown
Predicted Primers PCR Primer
(F):5'- TCTGTTTGGAGGCCAATCC -3'
(R):5'- ACTCCTACATCGACCTGCAG -3'

Sequencing Primer
(F):5'- GGGTCCCTTCCCAAGACACTC -3'
(R):5'- ATGCCAGCCTGGACTCAG -3'
Posted On2016-09-01