Incidental Mutation 'R5408:Kif13b'
ID426420
Institutional Source Beutler Lab
Gene Symbol Kif13b
Ensembl Gene ENSMUSG00000060012
Gene Namekinesin family member 13B
SynonymsN-3 kinesin, C130021D12Rik, 5330429L19Rik, GAKIN
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location64647265-64809617 bp(+) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) A to T at 64779689 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153168 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100473] [ENSMUST00000224503]
Predicted Effect probably null
Transcript: ENSMUST00000100473
SMART Domains Protein: ENSMUSP00000098041
Gene: ENSMUSG00000060012

DomainStartEndE-ValueType
KISc 3 361 1.4e-182 SMART
FHA 470 520 6.86e-1 SMART
low complexity region 546 560 N/A INTRINSIC
coiled coil region 617 646 N/A INTRINSIC
coiled coil region 669 701 N/A INTRINSIC
Pfam:KIF1B 756 802 4.1e-20 PFAM
Pfam:DUF3694 1003 1279 1.4e-37 PFAM
low complexity region 1514 1526 N/A INTRINSIC
low complexity region 1532 1548 N/A INTRINSIC
low complexity region 1574 1589 N/A INTRINSIC
low complexity region 1617 1630 N/A INTRINSIC
CAP_GLY 1719 1784 1.54e-29 SMART
low complexity region 1814 1826 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000224503
Meta Mutation Damage Score 0.9488 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit increased circulating cholesterol and factor VIII levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Kif13b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Kif13b APN 14 64669693 missense possibly damaging 0.81
IGL00485:Kif13b APN 14 64765073 missense possibly damaging 0.88
IGL00495:Kif13b APN 14 64714113 missense probably benign 0.07
IGL00556:Kif13b APN 14 64744888 missense probably damaging 1.00
IGL00571:Kif13b APN 14 64746417 missense probably damaging 0.99
IGL00590:Kif13b APN 14 64779462 missense probably damaging 1.00
IGL01650:Kif13b APN 14 64765145 missense probably benign 0.00
IGL01730:Kif13b APN 14 64750361 critical splice donor site probably null
IGL01908:Kif13b APN 14 64757558 missense probably damaging 1.00
IGL02388:Kif13b APN 14 64800358 missense probably damaging 1.00
IGL02573:Kif13b APN 14 64803431 missense probably damaging 1.00
IGL02661:Kif13b APN 14 64767691 missense probably benign 0.06
IGL02794:Kif13b APN 14 64803440 missense probably benign 0.00
IGL02959:Kif13b APN 14 64767717 missense probably damaging 1.00
IGL02979:Kif13b APN 14 64789697 missense probably damaging 0.96
IGL03114:Kif13b APN 14 64788448 missense probably benign 0.00
R0024:Kif13b UTSW 14 64750273 missense probably benign 0.30
R0330:Kif13b UTSW 14 64803220 missense probably benign
R0376:Kif13b UTSW 14 64757404 splice site probably benign
R0571:Kif13b UTSW 14 64751528 missense probably damaging 1.00
R0718:Kif13b UTSW 14 64751662 splice site probably benign
R1144:Kif13b UTSW 14 64714117 missense probably benign 0.01
R1183:Kif13b UTSW 14 64782377 missense probably benign 0.00
R1264:Kif13b UTSW 14 64776232 splice site probably benign
R1497:Kif13b UTSW 14 64736266 missense probably damaging 0.99
R1579:Kif13b UTSW 14 64782341 critical splice acceptor site probably null
R1624:Kif13b UTSW 14 64738619 missense probably damaging 0.99
R1706:Kif13b UTSW 14 64760666 splice site probably benign
R2176:Kif13b UTSW 14 64669671 missense probably benign 0.01
R3727:Kif13b UTSW 14 64765748 splice site probably benign
R3785:Kif13b UTSW 14 64800400 missense probably benign 0.00
R3786:Kif13b UTSW 14 64800400 missense probably benign 0.00
R4088:Kif13b UTSW 14 64767455 critical splice donor site probably null
R4279:Kif13b UTSW 14 64779356 missense probably damaging 1.00
R4559:Kif13b UTSW 14 64806132 missense probably damaging 0.98
R4689:Kif13b UTSW 14 64773064 missense probably damaging 1.00
R4692:Kif13b UTSW 14 64803575 missense probably benign 0.05
R4878:Kif13b UTSW 14 64806154 missense probably benign 0.00
R4971:Kif13b UTSW 14 64757562 missense possibly damaging 0.90
R5037:Kif13b UTSW 14 64758589 nonsense probably null
R5119:Kif13b UTSW 14 64757453 missense probably benign 0.01
R5167:Kif13b UTSW 14 64772935 missense probably damaging 1.00
R5437:Kif13b UTSW 14 64806114 missense probably damaging 0.99
R5756:Kif13b UTSW 14 64736305 missense probably damaging 1.00
R5838:Kif13b UTSW 14 64737555 missense probably damaging 1.00
R5891:Kif13b UTSW 14 64788405 splice site probably null
R6120:Kif13b UTSW 14 64751558 missense probably damaging 1.00
R6150:Kif13b UTSW 14 64751639 missense probably damaging 0.99
R6165:Kif13b UTSW 14 64742311 missense probably damaging 1.00
R6187:Kif13b UTSW 14 64736215 missense probably damaging 1.00
R6229:Kif13b UTSW 14 64738567 missense probably damaging 1.00
R6267:Kif13b UTSW 14 64738634 missense probably damaging 1.00
R6347:Kif13b UTSW 14 64767619 missense probably benign 0.26
R6479:Kif13b UTSW 14 64751525 missense probably benign 0.08
R6512:Kif13b UTSW 14 64744874 critical splice acceptor site probably null
R6851:Kif13b UTSW 14 64773065 missense probably damaging 1.00
R7131:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7217:Kif13b UTSW 14 64773068 missense probably damaging 1.00
R7398:Kif13b UTSW 14 64757523 missense probably null 0.02
R7427:Kif13b UTSW 14 64788460 missense probably benign
R7428:Kif13b UTSW 14 64788460 missense probably benign
R7573:Kif13b UTSW 14 64803658 missense probably benign 0.00
R7629:Kif13b UTSW 14 64779335 nonsense probably null
R7683:Kif13b UTSW 14 64757507 missense probably benign 0.24
R7835:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7895:Kif13b UTSW 14 64736149 missense probably damaging 1.00
R7918:Kif13b UTSW 14 64767452 missense probably benign 0.00
R7978:Kif13b UTSW 14 64736149 missense probably damaging 1.00
Z1176:Kif13b UTSW 14 64803344 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACTTGACTTTCTGGAGTCTGGC -3'
(R):5'- GGCCATGACACTCAAGCAAG -3'

Sequencing Primer
(F):5'- AGTCTGGCTTGAAGAGTTTACTC -3'
(R):5'- GCAAGCATCCTGGGTCTAACAG -3'
Posted On2016-09-01