Incidental Mutation 'R5408:Zhx1'
ID426421
Institutional Source Beutler Lab
Gene Symbol Zhx1
Ensembl Gene ENSMUSG00000022361
Gene Namezinc fingers and homeoboxes 1
Synonyms
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location58047003-58076541 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 58052423 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 809 (M809K)
Ref Sequence ENSEMBL: ENSMUSP00000134844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070143] [ENSMUST00000110168] [ENSMUST00000175805] [ENSMUST00000176076] [ENSMUST00000176935] [ENSMUST00000177176] [ENSMUST00000177276] [ENSMUST00000177504]
Predicted Effect probably damaging
Transcript: ENSMUST00000070143
AA Change: M809K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066201
Gene: ENSMUSG00000022361
AA Change: M809K

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110168
AA Change: M809K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000105797
Gene: ENSMUSG00000022361
AA Change: M809K

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000175805
AA Change: M809K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000134844
Gene: ENSMUSG00000022361
AA Change: M809K

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 630 5.01e-4 SMART
low complexity region 638 652 N/A INTRINSIC
HOX 660 722 9.8e-12 SMART
low complexity region 728 765 N/A INTRINSIC
HOX 777 832 5.01e-4 SMART
low complexity region 833 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176076
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176270
Predicted Effect probably benign
Transcript: ENSMUST00000176935
SMART Domains Protein: ENSMUSP00000134752
Gene: ENSMUSG00000022362

DomainStartEndE-ValueType
low complexity region 64 75 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177176
Predicted Effect probably benign
Transcript: ENSMUST00000177276
SMART Domains Protein: ENSMUSP00000135230
Gene: ENSMUSG00000022361

DomainStartEndE-ValueType
ZnF_C2H2 70 93 1.07e0 SMART
ZnF_C2H2 102 125 1.23e0 SMART
low complexity region 168 179 N/A INTRINSIC
low complexity region 216 238 N/A INTRINSIC
HOX 284 346 1.65e-4 SMART
HOX 464 526 6.93e-12 SMART
low complexity region 533 544 N/A INTRINSIC
low complexity region 547 554 N/A INTRINSIC
HOX 569 623 2.77e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177504
SMART Domains Protein: ENSMUSP00000135111
Gene: ENSMUSG00000022362

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
Meta Mutation Damage Score 0.7459 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 1 of this gene family. In addition to forming homodimers, this protein heterodimerizes with members 2 and 3 of the zinc fingers and homeoboxes family. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream chromosome 8 open reading frame 76 (C8orf76) gene. [provided by RefSeq, Feb 2011]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kcng3 T C 17: 83,631,005 D205G probably benign Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Zhx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00419:Zhx1 APN 15 58053315 missense probably damaging 1.00
IGL00819:Zhx1 APN 15 58054694 missense probably benign 0.00
IGL01025:Zhx1 APN 15 58054679 missense probably benign 0.32
IGL01867:Zhx1 APN 15 58054445 missense probably damaging 1.00
IGL02000:Zhx1 APN 15 58054287 missense probably damaging 1.00
IGL02093:Zhx1 APN 15 58052868 missense probably benign
IGL02156:Zhx1 APN 15 58054049 missense possibly damaging 0.89
IGL02399:Zhx1 APN 15 58053741 missense probably damaging 1.00
IGL02479:Zhx1 APN 15 58054371 missense probably damaging 1.00
R0667:Zhx1 UTSW 15 58053165 missense possibly damaging 0.63
R1502:Zhx1 UTSW 15 58054596 missense probably damaging 1.00
R2923:Zhx1 UTSW 15 58053681 missense probably damaging 0.99
R3039:Zhx1 UTSW 15 58053251 missense possibly damaging 0.91
R3401:Zhx1 UTSW 15 58054349 missense probably benign 0.13
R3403:Zhx1 UTSW 15 58054349 missense probably benign 0.13
R3979:Zhx1 UTSW 15 58053240 missense probably benign 0.14
R4086:Zhx1 UTSW 15 58052921 missense possibly damaging 0.93
R5013:Zhx1 UTSW 15 58054142 missense possibly damaging 0.61
R5124:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5125:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5180:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5181:Zhx1 UTSW 15 58054074 missense probably damaging 1.00
R5186:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5187:Zhx1 UTSW 15 58052423 missense probably damaging 0.99
R5490:Zhx1 UTSW 15 58053299 missense probably damaging 1.00
R5629:Zhx1 UTSW 15 58054811 missense probably damaging 1.00
R6314:Zhx1 UTSW 15 58054002 missense probably benign 0.01
R6768:Zhx1 UTSW 15 58054103 missense probably benign 0.27
R7081:Zhx1 UTSW 15 58054338 missense probably benign 0.00
R7211:Zhx1 UTSW 15 58053251 missense possibly damaging 0.91
R7219:Zhx1 UTSW 15 58054337 missense probably benign
R7232:Zhx1 UTSW 15 58053069 missense probably benign 0.04
R7275:Zhx1 UTSW 15 58054362 missense probably benign
R7287:Zhx1 UTSW 15 58053296 missense probably damaging 1.00
R7369:Zhx1 UTSW 15 58053300 missense probably damaging 1.00
R7381:Zhx1 UTSW 15 58053165 missense possibly damaging 0.63
R8103:Zhx1 UTSW 15 58053266 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TTCCGCTTCACATGTCGTGG -3'
(R):5'- TGAATGGTCTATCTTCCCTTAGGAG -3'

Sequencing Primer
(F):5'- GGGGTTCCCAAGTGTCACTATC -3'
(R):5'- CTATCTTCCCTTAGGAGAAGAGGG -3'
Posted On2016-09-01