Incidental Mutation 'R5408:Kcng3'
ID426424
Institutional Source Beutler Lab
Gene Symbol Kcng3
Ensembl Gene ENSMUSG00000045053
Gene Namepotassium voltage-gated channel, subfamily G, member 3
SynonymsKv10.1a, Kv10.1b, KV6.3
MMRRC Submission 042977-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.251) question?
Stock #R5408 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location83585957-83631895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83631005 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 205 (D205G)
Ref Sequence ENSEMBL: ENSMUSP00000054910 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051482]
Predicted Effect probably benign
Transcript: ENSMUST00000051482
AA Change: D205G

PolyPhen 2 Score 0.116 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000054910
Gene: ENSMUSG00000045053
AA Change: D205G

DomainStartEndE-ValueType
BTB 9 119 5.2e-5 SMART
Pfam:Ion_trans 167 417 4.6e-42 PFAM
Pfam:Ion_trans_2 321 411 4.3e-13 PFAM
Meta Mutation Damage Score 0.0610 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 99% (74/75)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily G. This member is a gamma subunit functioning as a modulatory molecule. Alternative splicing results in two transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032A03Rik T C 9: 50,764,757 N87S probably damaging Het
A430110L20Rik A G 1: 181,227,414 noncoding transcript Het
Actn2 T C 13: 12,270,795 I837V probably benign Het
Adora1 T A 1: 134,203,163 T257S probably benign Het
Akap9 T A 5: 4,058,458 M2954K possibly damaging Het
Akr1c13 G T 13: 4,194,716 A98S probably benign Het
Aldh2 C T 5: 121,570,557 probably benign Het
Ank1 A G 8: 23,082,193 N48D probably damaging Het
Ash1l A G 3: 88,982,394 T527A probably damaging Het
Atp13a1 T C 8: 69,796,840 V251A probably benign Het
Baz1a A T 12: 54,923,050 D608E probably damaging Het
Bend5 A T 4: 111,454,083 probably null Het
Blm T G 7: 80,502,622 T526P probably benign Het
Cacna1a T C 8: 84,549,707 V559A probably damaging Het
Cacna2d4 A G 6: 119,348,791 D1042G probably damaging Het
Cadps T C 14: 12,705,759 H212R possibly damaging Het
Cdh3 T C 8: 106,536,637 I106T probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Col16a1 A T 4: 130,093,105 probably benign Het
Dctn6 C T 8: 34,094,902 V89I possibly damaging Het
Dgkz C A 2: 91,935,823 G798W possibly damaging Het
Epb41l2 A T 10: 25,468,094 probably null Het
Fam171a2 T C 11: 102,437,518 K805R possibly damaging Het
Fam89b G T 19: 5,729,393 Y45* probably null Het
Fchsd2 A G 7: 101,271,574 N462S possibly damaging Het
Fyco1 T G 9: 123,829,503 H536P probably damaging Het
Galnt12 A T 4: 47,104,169 E142D probably damaging Het
Gspt1 C T 16: 11,253,855 G48D probably benign Het
H6pd A G 4: 149,982,865 S355P probably damaging Het
Hectd2 T C 19: 36,554,896 V38A possibly damaging Het
Jup C T 11: 100,376,781 R572Q probably damaging Het
Kif13b A T 14: 64,779,689 probably null Het
Mapk3 A G 7: 126,763,835 D253G probably damaging Het
Methig1 A T 15: 100,383,754 Y253F possibly damaging Het
Mmp3 T C 9: 7,449,904 S263P probably damaging Het
Mpo T A 11: 87,801,025 probably null Het
Nbeal2 C A 9: 110,637,520 G772W possibly damaging Het
Nr1d1 T A 11: 98,770,261 H393L probably benign Het
Obscn A G 11: 59,051,611 V4915A probably damaging Het
Olfml2b T A 1: 170,644,976 W19R probably damaging Het
Olfr1342 T C 4: 118,690,444 T3A probably benign Het
Olfr504 C T 7: 108,565,169 A209T probably damaging Het
Padi6 G A 4: 140,727,685 T647I probably damaging Het
Pcyox1 A G 6: 86,392,298 L113S probably damaging Het
Pde4dip T A 3: 97,796,736 T192S probably benign Het
Pip4k2a T C 2: 18,906,308 H87R probably benign Het
Pkd1l3 C A 8: 109,667,052 T2004N probably damaging Het
Prex1 CGTTGTTGTTGT CGTTGTTGTTGTTGT 2: 166,575,653 probably benign Het
Ptprz1 C T 6: 23,002,600 T1563I probably damaging Het
Reg3b T C 6: 78,373,232 V165A probably benign Het
Rreb1 A G 13: 37,931,344 D893G probably benign Het
Sap18 A T 14: 57,801,974 M78L probably benign Het
Scaper A T 9: 55,586,224 F1226I probably damaging Het
Scyl3 A T 1: 163,954,676 probably null Het
Shoc2 A G 19: 53,988,125 M149V probably benign Het
Slc7a2 G A 8: 40,915,005 R602K probably damaging Het
Sox30 A G 11: 45,991,867 I575V possibly damaging Het
Trim14 A T 4: 46,507,134 C361S possibly damaging Het
Ttn T C 2: 76,900,928 probably benign Het
Uncx A T 5: 139,544,490 K108* probably null Het
Usp54 A T 14: 20,550,433 L1412Q probably damaging Het
Uty A G Y: 1,245,614 V6A possibly damaging Het
Vmn1r30 C T 6: 58,435,044 V268I probably benign Het
Wdsub1 T C 2: 59,861,543 probably benign Het
Wipf3 A G 6: 54,481,911 I84V probably benign Het
Xcr1 T A 9: 123,856,566 I44F probably benign Het
Zfp687 T C 3: 95,009,275 probably benign Het
Zfp729b A T 13: 67,591,444 S901T probably benign Het
Zhx1 A T 15: 58,052,423 M809K probably damaging Het
Zswim9 T C 7: 13,260,826 K468E possibly damaging Het
Other mutations in Kcng3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01960:Kcng3 APN 17 83587850 missense probably damaging 1.00
PIT4403001:Kcng3 UTSW 17 83588182 missense probably damaging 1.00
R0034:Kcng3 UTSW 17 83588383 splice site probably benign
R0056:Kcng3 UTSW 17 83587756 missense probably damaging 0.98
R0335:Kcng3 UTSW 17 83587737 missense possibly damaging 0.51
R1224:Kcng3 UTSW 17 83631395 missense probably damaging 1.00
R1462:Kcng3 UTSW 17 83631063 missense probably damaging 0.96
R1601:Kcng3 UTSW 17 83588339 missense probably damaging 1.00
R3147:Kcng3 UTSW 17 83588320 missense possibly damaging 0.71
R4854:Kcng3 UTSW 17 83588306 missense probably damaging 0.97
R5719:Kcng3 UTSW 17 83631134 missense possibly damaging 0.71
R5791:Kcng3 UTSW 17 83588210 missense probably benign 0.02
R6155:Kcng3 UTSW 17 83588378 missense probably benign
R6437:Kcng3 UTSW 17 83631129 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATAGATTCCTCACACCCCTCGG -3'
(R):5'- AGATGATCTACTGGGGCCTG -3'

Sequencing Primer
(F):5'- ACACCCCTCGGCTGGAG -3'
(R):5'- ACCTGGAGTACTGCTGCCAG -3'
Posted On2016-09-01