Incidental Mutation 'R5409:Spag8'
ID 426439
Institutional Source Beutler Lab
Gene Symbol Spag8
Ensembl Gene ENSMUSG00000066196
Gene Name sperm associated antigen 8
Synonyms
MMRRC Submission 042978-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.066) question?
Stock # R5409 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 43651335-43653594 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) T to A at 43653134 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000030191] [ENSMUST00000030192] [ENSMUST00000084646] [ENSMUST00000107870] [ENSMUST00000107874]
AlphaFold Q3V0Q6
Predicted Effect probably benign
Transcript: ENSMUST00000030191
SMART Domains Protein: ENSMUSP00000030191
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 1.9e-45 PFAM
Pfam:Pkinase_Tyr 518 786 4.7e-39 PFAM
Pfam:Pkinase 535 785 1.2e-32 PFAM
CYCc 825 1019 3.28e-111 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000030192
SMART Domains Protein: ENSMUSP00000030192
Gene: ENSMUSG00000028470

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:DcpS_C 53 159 7.1e-25 PFAM
Pfam:HIT 61 158 1.5e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000084646
AA Change: H109L
SMART Domains Protein: ENSMUSP00000081696
Gene: ENSMUSG00000066196
AA Change: H109L

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000107870
AA Change: H109L
SMART Domains Protein: ENSMUSP00000103502
Gene: ENSMUSG00000066196
AA Change: H109L

DomainStartEndE-ValueType
low complexity region 26 48 N/A INTRINSIC
low complexity region 121 145 N/A INTRINSIC
low complexity region 148 175 N/A INTRINSIC
low complexity region 230 254 N/A INTRINSIC
low complexity region 303 316 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107874
SMART Domains Protein: ENSMUSP00000103506
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 44 399 5.7e-56 PFAM
Pfam:Pkinase_Tyr 518 786 4.1e-39 PFAM
Pfam:Pkinase 533 785 3.8e-34 PFAM
CYCc 825 989 4.37e-57 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123883
Predicted Effect probably benign
Transcript: ENSMUST00000128549
SMART Domains Protein: ENSMUSP00000114385
Gene: ENSMUSG00000028469

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Pfam:Pkinase_Tyr 84 352 1e-39 PFAM
Pfam:Pkinase 101 351 2.6e-33 PFAM
CYCc 391 585 3.28e-111 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143160
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130593
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151603
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130093
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134050
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145817
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134082
Predicted Effect probably benign
Transcript: ENSMUST00000149575
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein encoded by this gene is recognized by sperm agglutinating antibodies from an infertile woman. This protein is localized in germ cells of the testis at all stages of spermatogenesis and is localized to the acrosomal region of mature spermatozoa. This protein interacts with ACT (activator of CREM in testis) and may play a role in CREM (cAMP response element modulator)-ACT-mediated gene transcription during spermatogenesis. This protein may also play a role in spermatogenesis by regulating microtubule formation and cell division. Alternatively spliced variants that encode different protein isoforms have been described but the full-length sequences of only two have been determined. [provided by RefSeq, Jul 2012]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 79,850,154 (GRCm39) L2002P probably damaging Het
Acot11 C T 4: 106,617,327 (GRCm39) G240R probably damaging Het
Adgrl1 A G 8: 84,656,371 (GRCm39) T230A probably damaging Het
Anapc4 A G 5: 53,005,941 (GRCm39) E316G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,596,684 (GRCm39) probably benign Het
Aurka T G 2: 172,209,036 (GRCm39) Q33P possibly damaging Het
Ccn5 G A 2: 163,667,158 (GRCm39) C53Y probably damaging Het
Cenpm T C 15: 82,118,564 (GRCm39) T153A probably benign Het
Clca4b T A 3: 144,622,452 (GRCm39) K538* probably null Het
Clip2 G A 5: 134,551,645 (GRCm39) T159M possibly damaging Het
Col5a1 C T 2: 27,850,457 (GRCm39) T518I unknown Het
Dis3 A T 14: 99,323,368 (GRCm39) M566K possibly damaging Het
Dnah1 C T 14: 30,985,212 (GRCm39) R3869H probably damaging Het
Gm4775 A T 14: 106,338,386 (GRCm39) noncoding transcript Het
Hipk2 C T 6: 38,706,977 (GRCm39) G637D probably damaging Het
Igkv4-61 T C 6: 69,394,111 (GRCm39) K18E possibly damaging Het
Kcnk4 A G 19: 6,903,578 (GRCm39) S324P probably benign Het
Larp4 T C 15: 99,883,945 (GRCm39) C61R probably damaging Het
Nid2 T C 14: 19,856,030 (GRCm39) F986L probably damaging Het
Or5ac16 A G 16: 59,021,920 (GRCm39) Y290H probably damaging Het
Or5aq1b T C 2: 86,902,214 (GRCm39) E88G possibly damaging Het
Or5h22 C T 16: 58,894,559 (GRCm39) V295I possibly damaging Het
Pgbd5 T A 8: 125,098,619 (GRCm39) I359F probably damaging Het
Plekhh2 T C 17: 84,893,906 (GRCm39) probably null Het
Pomgnt2 A T 9: 121,811,303 (GRCm39) S493T possibly damaging Het
Rnf7l A T 10: 63,257,403 (GRCm39) M39K possibly damaging Het
Rp1l1 T C 14: 64,268,070 (GRCm39) S1219P probably benign Het
Rprd1b T A 2: 157,916,987 (GRCm39) F322L probably damaging Het
Sh3rf1 G A 8: 61,827,279 (GRCm39) V678M probably benign Het
Smpd5 C A 15: 76,179,914 (GRCm39) T321K probably damaging Het
Tanc2 T C 11: 105,758,311 (GRCm39) C691R possibly damaging Het
Tnc A C 4: 63,884,773 (GRCm39) M1834R probably damaging Het
Tnc A T 4: 63,925,654 (GRCm39) Y961N probably damaging Het
Ttn T C 2: 76,700,893 (GRCm39) probably benign Het
Ufl1 A G 4: 25,280,706 (GRCm39) V47A probably damaging Het
Unc13c T A 9: 73,485,672 (GRCm39) D1676V possibly damaging Het
Vmn1r65 T C 7: 6,012,012 (GRCm39) N74S possibly damaging Het
Vmn2r30 A G 7: 7,315,547 (GRCm39) F762S probably damaging Het
Other mutations in Spag8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Spag8 APN 4 43,652,890 (GRCm39) nonsense probably null
IGL01766:Spag8 APN 4 43,653,209 (GRCm39) unclassified probably benign
IGL02043:Spag8 APN 4 43,653,134 (GRCm39) unclassified probably benign
IGL02324:Spag8 APN 4 43,651,781 (GRCm39) missense probably damaging 1.00
IGL02812:Spag8 APN 4 43,651,755 (GRCm39) missense probably damaging 0.96
IGL03336:Spag8 APN 4 43,652,114 (GRCm39) splice site probably benign
R1519:Spag8 UTSW 4 43,652,777 (GRCm39) missense possibly damaging 0.88
R1799:Spag8 UTSW 4 43,653,345 (GRCm39) unclassified probably benign
R1799:Spag8 UTSW 4 43,653,087 (GRCm39) unclassified probably benign
R2212:Spag8 UTSW 4 43,651,606 (GRCm39) missense probably damaging 1.00
R2338:Spag8 UTSW 4 43,652,826 (GRCm39) missense probably benign 0.06
R3412:Spag8 UTSW 4 43,651,606 (GRCm39) missense probably damaging 1.00
R3413:Spag8 UTSW 4 43,651,606 (GRCm39) missense probably damaging 1.00
R3414:Spag8 UTSW 4 43,651,606 (GRCm39) missense probably damaging 1.00
R4666:Spag8 UTSW 4 43,653,408 (GRCm39) unclassified probably benign
R4670:Spag8 UTSW 4 43,653,378 (GRCm39) unclassified probably benign
R4745:Spag8 UTSW 4 43,651,636 (GRCm39) missense probably damaging 0.98
R4795:Spag8 UTSW 4 43,652,035 (GRCm39) missense possibly damaging 0.55
R5992:Spag8 UTSW 4 43,651,534 (GRCm39) missense probably benign 0.06
R6192:Spag8 UTSW 4 43,652,458 (GRCm39) missense probably damaging 1.00
R6333:Spag8 UTSW 4 43,653,186 (GRCm39) unclassified probably benign
R7216:Spag8 UTSW 4 43,652,034 (GRCm39) missense possibly damaging 0.55
R8923:Spag8 UTSW 4 43,651,471 (GRCm39) missense probably damaging 0.99
R8996:Spag8 UTSW 4 43,651,998 (GRCm39) missense probably damaging 1.00
R9116:Spag8 UTSW 4 43,653,231 (GRCm39) missense unknown
R9705:Spag8 UTSW 4 43,652,366 (GRCm39) missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- ACCCTTGAGGAATGCAGGTG -3'
(R):5'- ACAGAGCCCTCTTCTGACAG -3'

Sequencing Primer
(F):5'- GTGCTGAACTTAGGACCCTGTC -3'
(R):5'- TCTGACAGTCTTTACGGGGCAC -3'
Posted On 2016-09-01