Mutagenetix > Incidental Mutation

Incidental Mutation 'R5409:Clip2'

426445

Institutional Source

Beutler Lab

Gene Symbol

Clip2

Ensembl Gene

ENSMUSG00000063146

Gene Name

CAP-GLY domain containing linker protein 2

Synonyms

Cyln2, WSCR4, CLIP-115

MMRRC Submission

042978-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.264) question?

Stock #

R5409 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

134518237-134581288 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 134551645 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 159 (T159M)

Ref Sequence

ENSEMBL: ENSMUSP00000098212 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036999] [ENSMUST00000100647]

AlphaFold

Q9Z0H8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000036999
AA Change: T159M

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000037431
Gene: ENSMUSG00000063146
AA Change: T159M

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	457	N/A	INTRINSIC
low complexity region	504	519	N/A	INTRINSIC
coiled coil region	529	578	N/A	INTRINSIC
coiled coil region	640	982	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000100647
AA Change: T159M

PolyPhen 2 Score 0.460 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000098212
Gene: ENSMUSG00000063146
AA Change: T159M

Domain	Start	End	E-Value	Type
low complexity region	17	39	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
CAP_GLY	82	147	2.72e-30	SMART
CAP_GLY	222	287	1.15e-33	SMART
low complexity region	315	339	N/A	INTRINSIC
coiled coil region	355	496	N/A	INTRINSIC
low complexity region	539	554	N/A	INTRINSIC
coiled coil region	564	613	N/A	INTRINSIC
coiled coil region	675	1017	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202895

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of cytoplasmic linker proteins, which have been proposed to mediate the interaction between specific membranous organelles and microtubules. This protein was found to associate with both microtubules and an organelle called the dendritic lamellar body. This gene is hemizygously deleted in Williams syndrome, a multisystem developmental disorder caused by the deletion of contiguous genes at 7q11.23. Alternative splicing of this gene generates 2 transcript variants. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous and heterozygous for disruptions in this gene display growth deficiency, brain abnormalities and hippocampal dysfunction and deficits in motor coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 38 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca7	T	C	10: 79,850,154 (GRCm39)	L2002P	probably damaging	Het
Acot11	C	T	4: 106,617,327 (GRCm39)	G240R	probably damaging	Het
Adgrl1	A	G	8: 84,656,371 (GRCm39)	T230A	probably damaging	Het
Anapc4	A	G	5: 53,005,941 (GRCm39)	E316G	probably damaging	Het
Asic1	GCACC	GCACCACC	15: 99,596,684 (GRCm39)		probably benign	Het
Aurka	T	G	2: 172,209,036 (GRCm39)	Q33P	possibly damaging	Het
Ccn5	G	A	2: 163,667,158 (GRCm39)	C53Y	probably damaging	Het
Cenpm	T	C	15: 82,118,564 (GRCm39)	T153A	probably benign	Het
Clca4b	T	A	3: 144,622,452 (GRCm39)	K538*	probably null	Het
Col5a1	C	T	2: 27,850,457 (GRCm39)	T518I	unknown	Het
Dis3	A	T	14: 99,323,368 (GRCm39)	M566K	possibly damaging	Het
Dnah1	C	T	14: 30,985,212 (GRCm39)	R3869H	probably damaging	Het
Gm4775	A	T	14: 106,338,386 (GRCm39)		noncoding transcript	Het
Hipk2	C	T	6: 38,706,977 (GRCm39)	G637D	probably damaging	Het
Igkv4-61	T	C	6: 69,394,111 (GRCm39)	K18E	possibly damaging	Het
Kcnk4	A	G	19: 6,903,578 (GRCm39)	S324P	probably benign	Het
Larp4	T	C	15: 99,883,945 (GRCm39)	C61R	probably damaging	Het
Nid2	T	C	14: 19,856,030 (GRCm39)	F986L	probably damaging	Het
Or5ac16	A	G	16: 59,021,920 (GRCm39)	Y290H	probably damaging	Het
Or5aq1b	T	C	2: 86,902,214 (GRCm39)	E88G	possibly damaging	Het
Or5h22	C	T	16: 58,894,559 (GRCm39)	V295I	possibly damaging	Het
Pgbd5	T	A	8: 125,098,619 (GRCm39)	I359F	probably damaging	Het
Plekhh2	T	C	17: 84,893,906 (GRCm39)		probably null	Het
Pomgnt2	A	T	9: 121,811,303 (GRCm39)	S493T	possibly damaging	Het
Rnf7l	A	T	10: 63,257,403 (GRCm39)	M39K	possibly damaging	Het
Rp1l1	T	C	14: 64,268,070 (GRCm39)	S1219P	probably benign	Het
Rprd1b	T	A	2: 157,916,987 (GRCm39)	F322L	probably damaging	Het
Sh3rf1	G	A	8: 61,827,279 (GRCm39)	V678M	probably benign	Het
Smpd5	C	A	15: 76,179,914 (GRCm39)	T321K	probably damaging	Het
Spag8	T	A	4: 43,653,134 (GRCm39)		probably benign	Het
Tanc2	T	C	11: 105,758,311 (GRCm39)	C691R	possibly damaging	Het
Tnc	A	C	4: 63,884,773 (GRCm39)	M1834R	probably damaging	Het
Tnc	A	T	4: 63,925,654 (GRCm39)	Y961N	probably damaging	Het
Ttn	T	C	2: 76,700,893 (GRCm39)		probably benign	Het
Ufl1	A	G	4: 25,280,706 (GRCm39)	V47A	probably damaging	Het
Unc13c	T	A	9: 73,485,672 (GRCm39)	D1676V	possibly damaging	Het
Vmn1r65	T	C	7: 6,012,012 (GRCm39)	N74S	possibly damaging	Het
Vmn2r30	A	G	7: 7,315,547 (GRCm39)	F762S	probably damaging	Het

Other mutations in Clip2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Clip2	APN	5	134,529,011 (GRCm39)	splice site	probably benign
IGL01024:Clip2	APN	5	134,539,066 (GRCm39)	missense	probably damaging	1.00
IGL01103:Clip2	APN	5	134,521,204 (GRCm39)	missense	possibly damaging	0.64
IGL01726:Clip2	APN	5	134,551,518 (GRCm39)	missense	probably damaging	1.00
IGL01833:Clip2	APN	5	134,526,938 (GRCm39)	splice site	probably benign
IGL02174:Clip2	APN	5	134,523,118 (GRCm39)	missense	probably damaging	1.00
IGL02232:Clip2	APN	5	134,531,984 (GRCm39)	missense	probably damaging	1.00
IGL02271:Clip2	APN	5	134,531,425 (GRCm39)	missense	probably benign	0.35
IGL02471:Clip2	APN	5	134,546,876 (GRCm39)	missense	probably benign	0.04
IGL02690:Clip2	APN	5	134,539,013 (GRCm39)	splice site	probably benign
IGL03198:Clip2	APN	5	134,526,936 (GRCm39)	splice site	probably benign
IGL03269:Clip2	APN	5	134,545,748 (GRCm39)	missense	probably damaging	1.00
scissors	UTSW	5	134,546,853 (GRCm39)	nonsense	probably null
R0335:Clip2	UTSW	5	134,564,069 (GRCm39)	start gained	probably benign
R0422:Clip2	UTSW	5	134,526,967 (GRCm39)	missense	probably benign	0.04
R0519:Clip2	UTSW	5	134,545,005 (GRCm39)	missense	probably benign	0.01
R1169:Clip2	UTSW	5	134,521,104 (GRCm39)	missense	probably benign	0.36
R1642:Clip2	UTSW	5	134,532,107 (GRCm39)	missense	possibly damaging	0.89
R1718:Clip2	UTSW	5	134,531,783 (GRCm39)	nonsense	probably null
R1822:Clip2	UTSW	5	134,532,081 (GRCm39)	missense	probably benign	0.01
R1824:Clip2	UTSW	5	134,532,081 (GRCm39)	missense	probably benign	0.01
R2011:Clip2	UTSW	5	134,531,969 (GRCm39)	missense	probably damaging	1.00
R3106:Clip2	UTSW	5	134,551,918 (GRCm39)	missense	probably benign	0.12
R3890:Clip2	UTSW	5	134,551,847 (GRCm39)	missense	probably damaging	1.00
R3891:Clip2	UTSW	5	134,551,847 (GRCm39)	missense	probably damaging	1.00
R3892:Clip2	UTSW	5	134,551,847 (GRCm39)	missense	probably damaging	1.00
R4134:Clip2	UTSW	5	134,521,107 (GRCm39)	missense	probably benign	0.08
R4237:Clip2	UTSW	5	134,564,051 (GRCm39)	start gained	probably benign
R4239:Clip2	UTSW	5	134,564,051 (GRCm39)	start gained	probably benign
R4294:Clip2	UTSW	5	134,521,167 (GRCm39)	missense	probably benign	0.09
R4450:Clip2	UTSW	5	134,531,807 (GRCm39)	missense	possibly damaging	0.82
R4741:Clip2	UTSW	5	134,545,123 (GRCm39)	missense	probably benign	0.02
R5186:Clip2	UTSW	5	134,551,645 (GRCm39)	missense	possibly damaging	0.46
R5235:Clip2	UTSW	5	134,551,645 (GRCm39)	missense	possibly damaging	0.46
R5410:Clip2	UTSW	5	134,551,645 (GRCm39)	missense	possibly damaging	0.46
R5448:Clip2	UTSW	5	134,542,902 (GRCm39)	missense	probably benign	0.01
R5900:Clip2	UTSW	5	134,531,633 (GRCm39)	missense	possibly damaging	0.48
R6464:Clip2	UTSW	5	134,520,779 (GRCm39)	missense	probably benign	0.00
R7032:Clip2	UTSW	5	134,551,484 (GRCm39)	missense	probably damaging	1.00
R7152:Clip2	UTSW	5	134,525,095 (GRCm39)	missense	probably damaging	1.00
R7216:Clip2	UTSW	5	134,531,771 (GRCm39)	missense	probably benign	0.01
R7358:Clip2	UTSW	5	134,531,484 (GRCm39)	nonsense	probably null
R7725:Clip2	UTSW	5	134,546,853 (GRCm39)	nonsense	probably null
R8380:Clip2	UTSW	5	134,531,651 (GRCm39)	missense	probably damaging	0.96
R8680:Clip2	UTSW	5	134,531,462 (GRCm39)	missense	probably benign
R9095:Clip2	UTSW	5	134,532,254 (GRCm39)	missense	possibly damaging	0.93
R9158:Clip2	UTSW	5	134,521,251 (GRCm39)	missense	probably benign	0.00
R9277:Clip2	UTSW	5	134,528,963 (GRCm39)	missense	probably benign
R9300:Clip2	UTSW	5	134,526,942 (GRCm39)	critical splice donor site	probably null
R9457:Clip2	UTSW	5	134,531,584 (GRCm39)	missense	probably benign	0.00
R9491:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9605:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9630:Clip2	UTSW	5	134,531,934 (GRCm39)	missense	probably damaging	1.00
R9657:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9660:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9661:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9662:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9663:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9730:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9731:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9732:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9773:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9787:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
R9788:Clip2	UTSW	5	134,533,616 (GRCm39)	missense	probably benign	0.04
X0062:Clip2	UTSW	5	134,531,990 (GRCm39)	missense	probably benign	0.12
Z1177:Clip2	UTSW	5	134,551,853 (GRCm39)	missense	probably damaging	1.00
Z1177:Clip2	UTSW	5	134,545,689 (GRCm39)	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- ACTTACCAGCACACGGTCTC -3'
(R):5'- AAGTGGGTGATGACTTCCTG -3'

Sequencing Primer
(F):5'- CAGGTGGAGGTCCTTGTCAC -3'
(R):5'- TGCAGTACCTGGGTGAGACAC -3'

Posted On

2016-09-01