Incidental Mutation 'R5409:Larp4'
ID426468
Institutional Source Beutler Lab
Gene Symbol Larp4
Ensembl Gene ENSMUSG00000023025
Gene NameLa ribonucleoprotein domain family, member 4
Synonyms
MMRRC Submission 042978-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.420) question?
Stock #R5409 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location99970065-100016358 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99986064 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 61 (C61R)
Ref Sequence ENSEMBL: ENSMUSP00000155529 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057632] [ENSMUST00000100206] [ENSMUST00000230521] [ENSMUST00000230956] [ENSMUST00000231160]
Predicted Effect possibly damaging
Transcript: ENSMUST00000057632
AA Change: C60R

PolyPhen 2 Score 0.669 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086964
Gene: ENSMUSG00000023025
AA Change: C60R

DomainStartEndE-ValueType
LA 112 190 2.44e-40 SMART
RRM 195 265 3.28e-2 SMART
low complexity region 375 388 N/A INTRINSIC
low complexity region 433 453 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
low complexity region 651 663 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000100206
AA Change: C61R

PolyPhen 2 Score 0.472 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000097780
Gene: ENSMUSG00000023025
AA Change: C61R

DomainStartEndE-ValueType
LA 113 191 2.44e-40 SMART
RRM 196 266 3.28e-2 SMART
low complexity region 376 389 N/A INTRINSIC
low complexity region 434 454 N/A INTRINSIC
low complexity region 458 471 N/A INTRINSIC
low complexity region 652 664 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229891
Predicted Effect probably damaging
Transcript: ENSMUST00000230521
AA Change: C61R

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect possibly damaging
Transcript: ENSMUST00000230956
AA Change: C62R

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
Predicted Effect probably damaging
Transcript: ENSMUST00000231160
AA Change: C2R

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,014,320 L2002P probably damaging Het
Acot11 C T 4: 106,760,130 G240R probably damaging Het
Adgrl1 A G 8: 83,929,742 T230A probably damaging Het
Anapc4 A G 5: 52,848,599 E316G probably damaging Het
Asic1 GCACC GCACCACC 15: 99,698,803 probably benign Het
Aurka T G 2: 172,367,116 Q33P possibly damaging Het
Cenpm T C 15: 82,234,363 T153A probably benign Het
Clca4b T A 3: 144,916,691 K538* probably null Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Col5a1 C T 2: 27,960,445 T518I unknown Het
Dis3 A T 14: 99,085,932 M566K possibly damaging Het
Dnah1 C T 14: 31,263,255 R3869H probably damaging Het
Gm4775 A T 14: 106,100,952 noncoding transcript Het
Gm7075 A T 10: 63,421,624 M39K possibly damaging Het
Hipk2 C T 6: 38,730,042 G637D probably damaging Het
Igkv4-61 T C 6: 69,417,127 K18E possibly damaging Het
Kcnk4 A G 19: 6,926,210 S324P probably benign Het
Nid2 T C 14: 19,805,962 F986L probably damaging Het
Olfr1107 T C 2: 87,071,870 E88G possibly damaging Het
Olfr190 C T 16: 59,074,196 V295I possibly damaging Het
Olfr198 A G 16: 59,201,557 Y290H probably damaging Het
Pgbd5 T A 8: 124,371,880 I359F probably damaging Het
Plekhh2 T C 17: 84,586,478 probably null Het
Pomgnt2 A T 9: 121,982,237 S493T possibly damaging Het
Rp1l1 T C 14: 64,030,621 S1219P probably benign Het
Rprd1b T A 2: 158,075,067 F322L probably damaging Het
Sh3rf1 G A 8: 61,374,245 V678M probably benign Het
Smpd5 C A 15: 76,295,714 T321K probably damaging Het
Spag8 T A 4: 43,653,134 probably benign Het
Tanc2 T C 11: 105,867,485 C691R possibly damaging Het
Tnc A C 4: 63,966,536 M1834R probably damaging Het
Tnc A T 4: 64,007,417 Y961N probably damaging Het
Ttn T C 2: 76,870,549 probably benign Het
Ufl1 A G 4: 25,280,706 V47A probably damaging Het
Unc13c T A 9: 73,578,390 D1676V possibly damaging Het
Vmn1r65 T C 7: 6,009,013 N74S possibly damaging Het
Vmn2r30 A G 7: 7,312,548 F762S probably damaging Het
Wisp2 G A 2: 163,825,238 C53Y probably damaging Het
Other mutations in Larp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Larp4 APN 15 99987421 missense probably damaging 0.98
IGL01668:Larp4 APN 15 99987474 missense probably damaging 1.00
IGL01687:Larp4 APN 15 99996488 missense probably damaging 1.00
IGL02105:Larp4 APN 15 99986071 missense probably damaging 1.00
IGL02676:Larp4 APN 15 99990421 missense possibly damaging 0.94
IGL03286:Larp4 APN 15 99986086 missense probably damaging 1.00
Skewer UTSW 15 100007730 critical splice donor site probably null
R1076:Larp4 UTSW 15 99997430 missense probably benign 0.00
R1996:Larp4 UTSW 15 99984963 missense probably damaging 1.00
R2183:Larp4 UTSW 15 100011897 missense probably benign 0.16
R2260:Larp4 UTSW 15 99997396 missense possibly damaging 0.95
R3777:Larp4 UTSW 15 99990357 missense probably damaging 1.00
R3916:Larp4 UTSW 15 99990403 missense probably benign 0.00
R3962:Larp4 UTSW 15 100012145 missense probably damaging 1.00
R5059:Larp4 UTSW 15 100005290 missense probably damaging 1.00
R5081:Larp4 UTSW 15 99973017 intron probably benign
R5104:Larp4 UTSW 15 99986083 missense probably damaging 1.00
R5436:Larp4 UTSW 15 99986114 missense probably damaging 0.98
R6895:Larp4 UTSW 15 100007730 critical splice donor site probably null
R7316:Larp4 UTSW 15 100001017 missense probably benign
R7483:Larp4 UTSW 15 99991778 missense probably benign 0.01
R7510:Larp4 UTSW 15 99993377 missense probably benign 0.07
R8131:Larp4 UTSW 15 99994689 missense probably damaging 0.99
R8263:Larp4 UTSW 15 99986080 missense probably benign 0.00
R8322:Larp4 UTSW 15 100010356 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CATTTGGGTACATAGAGTGCTACC -3'
(R):5'- TGTCATGTTTACGGAAATGACG -3'

Sequencing Primer
(F):5'- GGGTACATAGAGTGCTACCTTATCC -3'
(R):5'- CGGAGAGCTAAAGACACTAAGTTCTC -3'
Posted On2016-09-01