Mutagenetix > Incidental Mutation

Incidental Mutation 'R5410:Rc3h1'

426477

Institutional Source

Beutler Lab

Gene Symbol

Rc3h1

Ensembl Gene

ENSMUSG00000040423

Gene Name

RING CCCH (C3H) domains 1

Synonyms

roquin, 5730557L09Rik

MMRRC Submission

042979-MU

Accession Numbers

Genbank: NM_001024952; MGI: 2685397

Is this an essential gene?

Possibly non essential (E-score: 0.330) question?

Stock #

R5410 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160906418-160974978 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 160964963 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 990 (R990L)

Ref Sequence

ENSEMBL: ENSMUSP00000124871 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035911] [ENSMUST00000161609]

AlphaFold

Q4VGL6

PDB Structure

X-ray structure of the ROQ domain from murine Roquin-1 [X-RAY DIFFRACTION]
X-ray structure of the ROQ domain from murine Roquin-1 in complex with a 23-mer Tnf-CDE RNA [X-RAY DIFFRACTION]
Crystal structure of N-terminus of Roquin [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000035911

SMART Domains

Protein: ENSMUSP00000037178
Gene: ENSMUSG00000040423

Domain	Start	End	E-Value	Type
RING	14	53	5.9e-8	SMART
low complexity region	201	212	N/A	INTRINSIC
Pfam:zf-CCCH	414	440	1.4e-4	PFAM
low complexity region	551	562	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	728	750	N/A	INTRINSIC
low complexity region	770	784	N/A	INTRINSIC
coiled coil region	954	983	N/A	INTRINSIC
low complexity region	994	1002	N/A	INTRINSIC
low complexity region	1084	1098	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161609
AA Change: R990L

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000124871
Gene: ENSMUSG00000040423
AA Change: R990L

Domain	Start	End	E-Value	Type
RING	14	53	1.25e-5	SMART
low complexity region	201	212	N/A	INTRINSIC
Pfam:zf-CCCH	414	440	5.3e-7	PFAM
low complexity region	551	562	N/A	INTRINSIC
low complexity region	626	636	N/A	INTRINSIC
low complexity region	728	750	N/A	INTRINSIC
low complexity region	770	784	N/A	INTRINSIC
coiled coil region	954	983	N/A	INTRINSIC
low complexity region	1003	1011	N/A	INTRINSIC
low complexity region	1093	1107	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing RING-type and C3H1-type zinc finger motifs. The encoded protein recognizes and binds to a constitutive decay element (CDE) in the 3' UTR of mRNAs, leading to mRNA deadenylation and degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: A single recessive mutation on this gene resulted in severe autoimmune disease with phenotype resembling human systemic lupus erythematosus. [provided by MGI curators]

Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,126,473		noncoding transcript	Het
Adam24	A	G	8: 40,681,064	M524V	probably benign	Het
Adamts20	T	A	15: 94,281,957	N1788I	possibly damaging	Het
Arfgef3	T	G	10: 18,611,237	I1350L	probably damaging	Het
Arhgap17	A	G	7: 123,297,493		probably null	Het
Ascl5	A	T	1: 136,051,188	I129F	probably damaging	Het
AU040320	A	T	4: 126,823,716	H362L	possibly damaging	Het
Bpifb9a	A	T	2: 154,270,235	N564Y	probably benign	Het
Cdon	G	T	9: 35,470,035	D574Y	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Ces1e	T	A	8: 93,210,442	I334F	possibly damaging	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Cntn3	T	A	6: 102,278,353	T195S	probably benign	Het
Csmd2	C	A	4: 128,548,819	H3221Q	probably benign	Het
Cyp2c68	T	C	19: 39,699,284	D423G	possibly damaging	Het
Dennd3	C	T	15: 73,547,448	T696M	probably benign	Het
Ep300	T	C	15: 81,648,854	M1704T	unknown	Het
Exoc2	A	G	13: 30,864,856	F738S	probably damaging	Het
Fis1	A	G	5: 136,965,566	E36G	probably damaging	Het
Galnt1	A	G	18: 24,267,547	I237V	probably benign	Het
Gspt1	A	T	16: 11,230,510	I416N	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hykk	G	A	9: 54,946,066	C224Y	probably damaging	Het
Ifi211	T	C	1: 173,906,263	T111A	probably benign	Het
Il17rd	T	C	14: 27,095,911	Y186H	probably damaging	Het
Klhl29	G	T	12: 5,091,366	N539K	probably benign	Het
Lmbr1l	T	C	15: 98,909,262	T213A	probably damaging	Het
Madd	C	T	2: 91,154,514	R1318Q	probably damaging	Het
Mecom	C	A	3: 29,997,721	A182S	probably benign	Het
Olfr1305	C	T	2: 111,873,292	A188T	probably damaging	Het
Olfr20	C	T	11: 73,353,806	P18S	probably benign	Het
Olfr272	C	A	4: 52,910,991	A268S	probably benign	Het
Olfr67	A	T	7: 103,787,374	V301E	probably damaging	Het
Otud4	T	A	8: 79,672,997	M780K	probably benign	Het
Pdia5	A	G	16: 35,453,536	V130A	probably damaging	Het
Phldb2	T	A	16: 45,825,612	H202L	possibly damaging	Het
Ppig	G	A	2: 69,735,897	G136E	probably null	Het
Prr14l	C	A	5: 32,827,777	R1458L	probably damaging	Het
Ptpn3	T	C	4: 57,205,019	Y714C	probably damaging	Het
Ptprr	T	C	10: 116,188,330	V182A	possibly damaging	Het
Rai14	A	G	15: 10,574,938	Y645H	probably damaging	Het
Rasgrp3	T	C	17: 75,497,047	I115T	probably benign	Het
Rdh5	T	A	10: 128,918,291	Q21L	probably benign	Het
Rfx8	A	G	1: 39,710,156		probably null	Het
Scap	A	G	9: 110,374,182		probably null	Het
Shank1	T	A	7: 44,351,822	S988R	unknown	Het
Slc16a14	T	A	1: 84,907,424	I465F	probably damaging	Het
Slc41a2	A	G	10: 83,281,368		probably null	Het
Tab2	T	C	10: 7,919,821	H225R	possibly damaging	Het
Tbx19	T	A	1: 165,160,372	N64I	probably damaging	Het
Tmprss11f	A	T	5: 86,530,106	I268K	probably damaging	Het
Tox2	A	G	2: 163,320,373	M388V	probably benign	Het
Trbv17	T	C	6: 41,163,538	L109P	probably damaging	Het
Trim72	A	G	7: 128,009,923	H299R	probably damaging	Het
Vmn1r63	C	T	7: 5,803,190	V148I	possibly damaging	Het
Zfp938	A	C	10: 82,225,258	H509Q	possibly damaging	Het
Zfyve16	A	G	13: 92,521,231	V724A	probably benign	Het
Zscan10	T	C	17: 23,610,421	F569L	probably damaging	Het

Other mutations in Rc3h1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
sanroque	APN	1	160940830	synonymous	probably benign
IGL00417:Rc3h1	APN	1	160955981	critical splice donor site	probably null
IGL02302:Rc3h1	APN	1	160938105	splice site	probably benign
IGL03053:Rc3h1	APN	1	160955817	missense	probably benign
IGL03275:Rc3h1	APN	1	160959555	critical splice donor site	probably null
curlyfry	UTSW	1	160959399	critical splice acceptor site	probably null
PIT4651001:Rc3h1	UTSW	1	160963540	missense	probably benign	0.04
R0528:Rc3h1	UTSW	1	160967658	missense	probably damaging	1.00
R0609:Rc3h1	UTSW	1	160930135	missense	probably damaging	1.00
R1620:Rc3h1	UTSW	1	160954973	missense	probably benign	0.02
R1661:Rc3h1	UTSW	1	160959423	missense	probably benign	0.29
R1665:Rc3h1	UTSW	1	160959423	missense	probably benign	0.29
R2027:Rc3h1	UTSW	1	160954937	missense	probably benign	0.03
R2145:Rc3h1	UTSW	1	160930257	missense	probably damaging	1.00
R2207:Rc3h1	UTSW	1	160940025	missense	probably damaging	0.97
R2227:Rc3h1	UTSW	1	160963542	missense	probably benign	0.07
R2348:Rc3h1	UTSW	1	160950860	missense	probably damaging	1.00
R2925:Rc3h1	UTSW	1	160954976	missense	probably damaging	1.00
R3977:Rc3h1	UTSW	1	160959399	critical splice acceptor site	probably null
R5071:Rc3h1	UTSW	1	160959477	missense	possibly damaging	0.76
R5177:Rc3h1	UTSW	1	160951652	missense	probably damaging	1.00
R5421:Rc3h1	UTSW	1	160951830	critical splice donor site	probably null
R5699:Rc3h1	UTSW	1	160930253	missense	probably damaging	1.00
R5873:Rc3h1	UTSW	1	160959501	missense	probably damaging	0.99
R7672:Rc3h1	UTSW	1	160950884	missense	probably damaging	0.99
R8163:Rc3h1	UTSW	1	160955059	missense	probably damaging	1.00
R8271:Rc3h1	UTSW	1	160940759	intron	probably benign
R8424:Rc3h1	UTSW	1	160965772	missense	probably damaging	1.00
R8746:Rc3h1	UTSW	1	160930174	missense	probably damaging	1.00
R8805:Rc3h1	UTSW	1	160967652	missense	probably benign	0.10
R8960:Rc3h1	UTSW	1	160946594	missense	probably damaging	0.98
R8980:Rc3h1	UTSW	1	160955025	missense	probably benign	0.11
R9011:Rc3h1	UTSW	1	160965103	missense	probably damaging	1.00
R9688:Rc3h1	UTSW	1	160942664	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGTACATCGCAACATTCACAC -3'
(R):5'- AGAGTCACAGAGTTCATTCCACC -3'

Sequencing Primer
(F):5'- CTGTCTCTCTCTCTCGAAAATAAAAC -3'
(R):5'- ACAGAGTTCATTCCACCTTCCC -3'

Posted On

2016-09-01