Incidental Mutation 'R5410:Rc3h1'
ID 426477
Institutional Source Beutler Lab
Gene Symbol Rc3h1
Ensembl Gene ENSMUSG00000040423
Gene Name RING CCCH (C3H) domains 1
Synonyms roquin, 5730557L09Rik
MMRRC Submission 042979-MU
Accession Numbers

Genbank: NM_001024952; MGI: 2685397

Is this an essential gene? Possibly non essential (E-score: 0.330) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 160906418-160974978 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to T at 160964963 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 990 (R990L)
Ref Sequence ENSEMBL: ENSMUSP00000124871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035911] [ENSMUST00000161609]
AlphaFold Q4VGL6
PDB Structure X-ray structure of the ROQ domain from murine Roquin-1 [X-RAY DIFFRACTION]
X-ray structure of the ROQ domain from murine Roquin-1 in complex with a 23-mer Tnf-CDE RNA [X-RAY DIFFRACTION]
Crystal structure of N-terminus of Roquin [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000035911
SMART Domains Protein: ENSMUSP00000037178
Gene: ENSMUSG00000040423

DomainStartEndE-ValueType
RING 14 53 5.9e-8 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 1.4e-4 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 994 1002 N/A INTRINSIC
low complexity region 1084 1098 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000161609
AA Change: R990L

PolyPhen 2 Score 0.466 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000124871
Gene: ENSMUSG00000040423
AA Change: R990L

DomainStartEndE-ValueType
RING 14 53 1.25e-5 SMART
low complexity region 201 212 N/A INTRINSIC
Pfam:zf-CCCH 414 440 5.3e-7 PFAM
low complexity region 551 562 N/A INTRINSIC
low complexity region 626 636 N/A INTRINSIC
low complexity region 728 750 N/A INTRINSIC
low complexity region 770 784 N/A INTRINSIC
coiled coil region 954 983 N/A INTRINSIC
low complexity region 1003 1011 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing RING-type and C3H1-type zinc finger motifs. The encoded protein recognizes and binds to a constitutive decay element (CDE) in the 3' UTR of mRNAs, leading to mRNA deadenylation and degradation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: A single recessive mutation on this gene resulted in severe autoimmune disease with phenotype resembling human systemic lupus erythematosus. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,126,473 noncoding transcript Het
Adam24 A G 8: 40,681,064 M524V probably benign Het
Adamts20 T A 15: 94,281,957 N1788I possibly damaging Het
Arfgef3 T G 10: 18,611,237 I1350L probably damaging Het
Arhgap17 A G 7: 123,297,493 probably null Het
Ascl5 A T 1: 136,051,188 I129F probably damaging Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bpifb9a A T 2: 154,270,235 N564Y probably benign Het
Cdon G T 9: 35,470,035 D574Y probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Ces1e T A 8: 93,210,442 I334F possibly damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Cntn3 T A 6: 102,278,353 T195S probably benign Het
Csmd2 C A 4: 128,548,819 H3221Q probably benign Het
Cyp2c68 T C 19: 39,699,284 D423G possibly damaging Het
Dennd3 C T 15: 73,547,448 T696M probably benign Het
Ep300 T C 15: 81,648,854 M1704T unknown Het
Exoc2 A G 13: 30,864,856 F738S probably damaging Het
Fis1 A G 5: 136,965,566 E36G probably damaging Het
Galnt1 A G 18: 24,267,547 I237V probably benign Het
Gspt1 A T 16: 11,230,510 I416N probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hykk G A 9: 54,946,066 C224Y probably damaging Het
Ifi211 T C 1: 173,906,263 T111A probably benign Het
Il17rd T C 14: 27,095,911 Y186H probably damaging Het
Klhl29 G T 12: 5,091,366 N539K probably benign Het
Lmbr1l T C 15: 98,909,262 T213A probably damaging Het
Madd C T 2: 91,154,514 R1318Q probably damaging Het
Mecom C A 3: 29,997,721 A182S probably benign Het
Olfr1305 C T 2: 111,873,292 A188T probably damaging Het
Olfr20 C T 11: 73,353,806 P18S probably benign Het
Olfr272 C A 4: 52,910,991 A268S probably benign Het
Olfr67 A T 7: 103,787,374 V301E probably damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
Pdia5 A G 16: 35,453,536 V130A probably damaging Het
Phldb2 T A 16: 45,825,612 H202L possibly damaging Het
Ppig G A 2: 69,735,897 G136E probably null Het
Prr14l C A 5: 32,827,777 R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 Y714C probably damaging Het
Ptprr T C 10: 116,188,330 V182A possibly damaging Het
Rai14 A G 15: 10,574,938 Y645H probably damaging Het
Rasgrp3 T C 17: 75,497,047 I115T probably benign Het
Rdh5 T A 10: 128,918,291 Q21L probably benign Het
Rfx8 A G 1: 39,710,156 probably null Het
Scap A G 9: 110,374,182 probably null Het
Shank1 T A 7: 44,351,822 S988R unknown Het
Slc16a14 T A 1: 84,907,424 I465F probably damaging Het
Slc41a2 A G 10: 83,281,368 probably null Het
Tab2 T C 10: 7,919,821 H225R possibly damaging Het
Tbx19 T A 1: 165,160,372 N64I probably damaging Het
Tmprss11f A T 5: 86,530,106 I268K probably damaging Het
Tox2 A G 2: 163,320,373 M388V probably benign Het
Trbv17 T C 6: 41,163,538 L109P probably damaging Het
Trim72 A G 7: 128,009,923 H299R probably damaging Het
Vmn1r63 C T 7: 5,803,190 V148I possibly damaging Het
Zfp938 A C 10: 82,225,258 H509Q possibly damaging Het
Zfyve16 A G 13: 92,521,231 V724A probably benign Het
Zscan10 T C 17: 23,610,421 F569L probably damaging Het
Other mutations in Rc3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
sanroque APN 1 160940830 synonymous probably benign
IGL00417:Rc3h1 APN 1 160955981 critical splice donor site probably null
IGL02302:Rc3h1 APN 1 160938105 splice site probably benign
IGL03053:Rc3h1 APN 1 160955817 missense probably benign
IGL03275:Rc3h1 APN 1 160959555 critical splice donor site probably null
curlyfry UTSW 1 160959399 critical splice acceptor site probably null
PIT4651001:Rc3h1 UTSW 1 160963540 missense probably benign 0.04
R0528:Rc3h1 UTSW 1 160967658 missense probably damaging 1.00
R0609:Rc3h1 UTSW 1 160930135 missense probably damaging 1.00
R1620:Rc3h1 UTSW 1 160954973 missense probably benign 0.02
R1661:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R1665:Rc3h1 UTSW 1 160959423 missense probably benign 0.29
R2027:Rc3h1 UTSW 1 160954937 missense probably benign 0.03
R2145:Rc3h1 UTSW 1 160930257 missense probably damaging 1.00
R2207:Rc3h1 UTSW 1 160940025 missense probably damaging 0.97
R2227:Rc3h1 UTSW 1 160963542 missense probably benign 0.07
R2348:Rc3h1 UTSW 1 160950860 missense probably damaging 1.00
R2925:Rc3h1 UTSW 1 160954976 missense probably damaging 1.00
R3977:Rc3h1 UTSW 1 160959399 critical splice acceptor site probably null
R5071:Rc3h1 UTSW 1 160959477 missense possibly damaging 0.76
R5177:Rc3h1 UTSW 1 160951652 missense probably damaging 1.00
R5421:Rc3h1 UTSW 1 160951830 critical splice donor site probably null
R5699:Rc3h1 UTSW 1 160930253 missense probably damaging 1.00
R5873:Rc3h1 UTSW 1 160959501 missense probably damaging 0.99
R7672:Rc3h1 UTSW 1 160950884 missense probably damaging 0.99
R8163:Rc3h1 UTSW 1 160955059 missense probably damaging 1.00
R8271:Rc3h1 UTSW 1 160940759 intron probably benign
R8424:Rc3h1 UTSW 1 160965772 missense probably damaging 1.00
R8746:Rc3h1 UTSW 1 160930174 missense probably damaging 1.00
R8805:Rc3h1 UTSW 1 160967652 missense probably benign 0.10
R8960:Rc3h1 UTSW 1 160946594 missense probably damaging 0.98
R8980:Rc3h1 UTSW 1 160955025 missense probably benign 0.11
R9011:Rc3h1 UTSW 1 160965103 missense probably damaging 1.00
R9688:Rc3h1 UTSW 1 160942664 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTACATCGCAACATTCACAC -3'
(R):5'- AGAGTCACAGAGTTCATTCCACC -3'

Sequencing Primer
(F):5'- CTGTCTCTCTCTCTCGAAAATAAAAC -3'
(R):5'- ACAGAGTTCATTCCACCTTCCC -3'
Posted On 2016-09-01