Incidental Mutation 'R5410:Ifi211'
ID 426479
Institutional Source Beutler Lab
Gene Symbol Ifi211
Ensembl Gene ENSMUSG00000026536
Gene Name interferon activated gene 211
Synonyms Ifi205b, Mnda
MMRRC Submission 042979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 173896345-173913046 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 173906263 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 111 (T111A)
Ref Sequence ENSEMBL: ENSMUSP00000009340 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009340] [ENSMUST00000111210]
AlphaFold P0DOV1
PDB Structure Solution structures of the PAAD_DAPIN domain of mus musculus interferon-activatable protein 205 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000009340
AA Change: T111A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000009340
Gene: ENSMUSG00000026536
AA Change: T111A

DomainStartEndE-ValueType
PYRIN 6 84 1.94e-14 SMART
low complexity region 120 154 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
Pfam:HIN 225 393 2.2e-76 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111210
SMART Domains Protein: ENSMUSP00000106841
Gene: ENSMUSG00000090272

DomainStartEndE-ValueType
PYRIN 5 83 3.71e-20 SMART
internal_repeat_1 152 166 2.38e-7 PROSPERO
low complexity region 170 200 N/A INTRINSIC
internal_repeat_1 208 222 2.38e-7 PROSPERO
low complexity region 225 249 N/A INTRINSIC
low complexity region 276 292 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
Pfam:HIN 311 479 3.4e-76 PFAM
low complexity region 497 507 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the interferon-regulated 200 family of proteins, which contain an N-terminal pyrin domain that is proposed to function in cell death and a partially conserved 220 amino acid domain. Expression of this protein in embryonic stem cells is critical for the DNA damage response and regulation of cell survival. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,126,473 noncoding transcript Het
Adam24 A G 8: 40,681,064 M524V probably benign Het
Adamts20 T A 15: 94,281,957 N1788I possibly damaging Het
Arfgef3 T G 10: 18,611,237 I1350L probably damaging Het
Arhgap17 A G 7: 123,297,493 probably null Het
Ascl5 A T 1: 136,051,188 I129F probably damaging Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bpifb9a A T 2: 154,270,235 N564Y probably benign Het
Cdon G T 9: 35,470,035 D574Y probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Ces1e T A 8: 93,210,442 I334F possibly damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Cntn3 T A 6: 102,278,353 T195S probably benign Het
Csmd2 C A 4: 128,548,819 H3221Q probably benign Het
Cyp2c68 T C 19: 39,699,284 D423G possibly damaging Het
Dennd3 C T 15: 73,547,448 T696M probably benign Het
Ep300 T C 15: 81,648,854 M1704T unknown Het
Exoc2 A G 13: 30,864,856 F738S probably damaging Het
Fis1 A G 5: 136,965,566 E36G probably damaging Het
Galnt1 A G 18: 24,267,547 I237V probably benign Het
Gspt1 A T 16: 11,230,510 I416N probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hykk G A 9: 54,946,066 C224Y probably damaging Het
Il17rd T C 14: 27,095,911 Y186H probably damaging Het
Klhl29 G T 12: 5,091,366 N539K probably benign Het
Lmbr1l T C 15: 98,909,262 T213A probably damaging Het
Madd C T 2: 91,154,514 R1318Q probably damaging Het
Mecom C A 3: 29,997,721 A182S probably benign Het
Olfr1305 C T 2: 111,873,292 A188T probably damaging Het
Olfr20 C T 11: 73,353,806 P18S probably benign Het
Olfr272 C A 4: 52,910,991 A268S probably benign Het
Olfr67 A T 7: 103,787,374 V301E probably damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
Pdia5 A G 16: 35,453,536 V130A probably damaging Het
Phldb2 T A 16: 45,825,612 H202L possibly damaging Het
Ppig G A 2: 69,735,897 G136E probably null Het
Prr14l C A 5: 32,827,777 R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 Y714C probably damaging Het
Ptprr T C 10: 116,188,330 V182A possibly damaging Het
Rai14 A G 15: 10,574,938 Y645H probably damaging Het
Rasgrp3 T C 17: 75,497,047 I115T probably benign Het
Rc3h1 G T 1: 160,964,963 R990L possibly damaging Het
Rdh5 T A 10: 128,918,291 Q21L probably benign Het
Rfx8 A G 1: 39,710,156 probably null Het
Scap A G 9: 110,374,182 probably null Het
Shank1 T A 7: 44,351,822 S988R unknown Het
Slc16a14 T A 1: 84,907,424 I465F probably damaging Het
Slc41a2 A G 10: 83,281,368 probably null Het
Tab2 T C 10: 7,919,821 H225R possibly damaging Het
Tbx19 T A 1: 165,160,372 N64I probably damaging Het
Tmprss11f A T 5: 86,530,106 I268K probably damaging Het
Tox2 A G 2: 163,320,373 M388V probably benign Het
Trbv17 T C 6: 41,163,538 L109P probably damaging Het
Trim72 A G 7: 128,009,923 H299R probably damaging Het
Vmn1r63 C T 7: 5,803,190 V148I possibly damaging Het
Zfp938 A C 10: 82,225,258 H509Q possibly damaging Het
Zfyve16 A G 13: 92,521,231 V724A probably benign Het
Zscan10 T C 17: 23,610,421 F569L probably damaging Het
Other mutations in Ifi211
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03258:Ifi211 APN 1 173905532 missense probably benign 0.40
IGL03304:Ifi211 APN 1 173907707 missense probably damaging 1.00
BB007:Ifi211 UTSW 1 173906203 missense possibly damaging 0.91
BB017:Ifi211 UTSW 1 173906203 missense possibly damaging 0.91
FR4548:Ifi211 UTSW 1 173906193 missense possibly damaging 0.85
R1686:Ifi211 UTSW 1 173899403 missense probably damaging 0.99
R2011:Ifi211 UTSW 1 173907603 missense probably damaging 0.99
R4657:Ifi211 UTSW 1 173907660 missense probably benign 0.03
R5220:Ifi211 UTSW 1 173907696 missense probably damaging 1.00
R6644:Ifi211 UTSW 1 173905552 missense probably benign 0.42
R6953:Ifi211 UTSW 1 173906266 missense probably damaging 1.00
R7451:Ifi211 UTSW 1 173899492 missense probably damaging 1.00
R7567:Ifi211 UTSW 1 173901835 missense probably damaging 1.00
R7667:Ifi211 UTSW 1 173899454 missense probably damaging 1.00
R7930:Ifi211 UTSW 1 173906203 missense possibly damaging 0.91
R8499:Ifi211 UTSW 1 173905520 missense probably benign 0.40
R9002:Ifi211 UTSW 1 173906328 missense possibly damaging 0.68
R9299:Ifi211 UTSW 1 173907722 missense probably damaging 0.96
R9562:Ifi211 UTSW 1 173905486 missense probably benign 0.43
Z1088:Ifi211 UTSW 1 173907660 missense possibly damaging 0.74
Predicted Primers PCR Primer
(F):5'- GGGAAGAAATCACCTCTGCC -3'
(R):5'- CAAAAGTTGTGCCTTTAGAGTTGTG -3'

Sequencing Primer
(F):5'- GAAGAAATCACCTCTGCCTGTCTG -3'
(R):5'- GCATCGATATAAATGCACCAGAG -3'
Posted On 2016-09-01