Incidental Mutation 'R5410:Olfr272'
ID 426486
Institutional Source Beutler Lab
Gene Symbol Olfr272
Ensembl Gene ENSMUSG00000051593
Gene Name olfactory receptor 272
Synonyms GA_x6K02T2N78B-7084885-7085844, MOR262-7
MMRRC Submission 042979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 52910207-52919178 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 52910991 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Alanine to Serine at position 268 (A268S)
Ref Sequence ENSEMBL: ENSMUSP00000149339 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051600] [ENSMUST00000107667] [ENSMUST00000213989]
AlphaFold Q8VGA0
Predicted Effect probably benign
Transcript: ENSMUST00000051600
AA Change: A268S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000055721
Gene: ENSMUSG00000051593
AA Change: A268S

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.6e-54 PFAM
Pfam:7tm_1 41 296 9.5e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107667
AA Change: A268S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000103294
Gene: ENSMUSG00000051593
AA Change: A268S

DomainStartEndE-ValueType
Pfam:7tm_1 39 294 9.5e-33 PFAM
Pfam:7tm_4 138 287 3.3e-42 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000213989
AA Change: A268S

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217085
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,126,473 noncoding transcript Het
Adam24 A G 8: 40,681,064 M524V probably benign Het
Adamts20 T A 15: 94,281,957 N1788I possibly damaging Het
Arfgef3 T G 10: 18,611,237 I1350L probably damaging Het
Arhgap17 A G 7: 123,297,493 probably null Het
Ascl5 A T 1: 136,051,188 I129F probably damaging Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bpifb9a A T 2: 154,270,235 N564Y probably benign Het
Cdon G T 9: 35,470,035 D574Y probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Ces1e T A 8: 93,210,442 I334F possibly damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Cntn3 T A 6: 102,278,353 T195S probably benign Het
Csmd2 C A 4: 128,548,819 H3221Q probably benign Het
Cyp2c68 T C 19: 39,699,284 D423G possibly damaging Het
Dennd3 C T 15: 73,547,448 T696M probably benign Het
Ep300 T C 15: 81,648,854 M1704T unknown Het
Exoc2 A G 13: 30,864,856 F738S probably damaging Het
Fis1 A G 5: 136,965,566 E36G probably damaging Het
Galnt1 A G 18: 24,267,547 I237V probably benign Het
Gspt1 A T 16: 11,230,510 I416N probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hykk G A 9: 54,946,066 C224Y probably damaging Het
Ifi211 T C 1: 173,906,263 T111A probably benign Het
Il17rd T C 14: 27,095,911 Y186H probably damaging Het
Klhl29 G T 12: 5,091,366 N539K probably benign Het
Lmbr1l T C 15: 98,909,262 T213A probably damaging Het
Madd C T 2: 91,154,514 R1318Q probably damaging Het
Mecom C A 3: 29,997,721 A182S probably benign Het
Olfr1305 C T 2: 111,873,292 A188T probably damaging Het
Olfr20 C T 11: 73,353,806 P18S probably benign Het
Olfr67 A T 7: 103,787,374 V301E probably damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
Pdia5 A G 16: 35,453,536 V130A probably damaging Het
Phldb2 T A 16: 45,825,612 H202L possibly damaging Het
Ppig G A 2: 69,735,897 G136E probably null Het
Prr14l C A 5: 32,827,777 R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 Y714C probably damaging Het
Ptprr T C 10: 116,188,330 V182A possibly damaging Het
Rai14 A G 15: 10,574,938 Y645H probably damaging Het
Rasgrp3 T C 17: 75,497,047 I115T probably benign Het
Rc3h1 G T 1: 160,964,963 R990L possibly damaging Het
Rdh5 T A 10: 128,918,291 Q21L probably benign Het
Rfx8 A G 1: 39,710,156 probably null Het
Scap A G 9: 110,374,182 probably null Het
Shank1 T A 7: 44,351,822 S988R unknown Het
Slc16a14 T A 1: 84,907,424 I465F probably damaging Het
Slc41a2 A G 10: 83,281,368 probably null Het
Tab2 T C 10: 7,919,821 H225R possibly damaging Het
Tbx19 T A 1: 165,160,372 N64I probably damaging Het
Tmprss11f A T 5: 86,530,106 I268K probably damaging Het
Tox2 A G 2: 163,320,373 M388V probably benign Het
Trbv17 T C 6: 41,163,538 L109P probably damaging Het
Trim72 A G 7: 128,009,923 H299R probably damaging Het
Vmn1r63 C T 7: 5,803,190 V148I possibly damaging Het
Zfp938 A C 10: 82,225,258 H509Q possibly damaging Het
Zfyve16 A G 13: 92,521,231 V724A probably benign Het
Zscan10 T C 17: 23,610,421 F569L probably damaging Het
Other mutations in Olfr272
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Olfr272 APN 4 52911618 missense possibly damaging 0.95
IGL02224:Olfr272 APN 4 52911392 missense probably damaging 0.97
IGL03293:Olfr272 APN 4 52910835 makesense probably null
K3955:Olfr272 UTSW 4 52911081 missense probably damaging 1.00
R0195:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R0197:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R0445:Olfr272 UTSW 4 52910849 missense probably benign 0.00
R1517:Olfr272 UTSW 4 52911502 nonsense probably null
R1536:Olfr272 UTSW 4 52911260 missense probably benign 0.43
R1540:Olfr272 UTSW 4 52910996 missense probably benign 0.00
R1551:Olfr272 UTSW 4 52911397 nonsense probably null
R1612:Olfr272 UTSW 4 52911501 missense probably benign
R1920:Olfr272 UTSW 4 52910849 missense probably benign
R2181:Olfr272 UTSW 4 52911524 missense probably damaging 1.00
R6331:Olfr272 UTSW 4 52911399 missense probably damaging 1.00
R6336:Olfr272 UTSW 4 52911459 missense probably damaging 1.00
R7085:Olfr272 UTSW 4 52910961 missense probably benign 0.02
R7541:Olfr272 UTSW 4 52911376 missense probably benign 0.04
R7727:Olfr272 UTSW 4 52911368 missense possibly damaging 0.89
R7891:Olfr272 UTSW 4 52911663 missense probably benign 0.01
R8782:Olfr272 UTSW 4 52911693 missense probably benign 0.16
R9321:Olfr272 UTSW 4 52911314 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCAAGTAGACAGTCCTGTAATC -3'
(R):5'- AACGTGATCAGCCTAACAGGG -3'

Sequencing Primer
(F):5'- TCTGAACAGCAGCCTTCA -3'
(R):5'- GCCTAACAGGGTCAAATCTGC -3'
Posted On 2016-09-01