Incidental Mutation 'R5410:Ptpn3'
ID 426487
Institutional Source Beutler Lab
Gene Symbol Ptpn3
Ensembl Gene ENSMUSG00000038764
Gene Name protein tyrosine phosphatase, non-receptor type 3
Synonyms 9530011I20Rik, PTPCL, PTP-H1
MMRRC Submission 042979-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.667) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 57190841-57301837 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 57205019 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 714 (Y714C)
Ref Sequence ENSEMBL: ENSMUSP00000075063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075637]
AlphaFold A2ALK8
Predicted Effect probably damaging
Transcript: ENSMUST00000075637
AA Change: Y714C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075063
Gene: ENSMUSG00000038764
AA Change: Y714C

DomainStartEndE-ValueType
B41 25 222 2.44e-67 SMART
FERM_C 226 316 2.64e-25 SMART
low complexity region 454 470 N/A INTRINSIC
PDZ 519 598 1.65e-15 SMART
PTPc 645 903 5.66e-117 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, especially in males, and male mice exhibit increased bone mineral content. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,126,473 noncoding transcript Het
Adam24 A G 8: 40,681,064 M524V probably benign Het
Adamts20 T A 15: 94,281,957 N1788I possibly damaging Het
Arfgef3 T G 10: 18,611,237 I1350L probably damaging Het
Arhgap17 A G 7: 123,297,493 probably null Het
Ascl5 A T 1: 136,051,188 I129F probably damaging Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bpifb9a A T 2: 154,270,235 N564Y probably benign Het
Cdon G T 9: 35,470,035 D574Y probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Ces1e T A 8: 93,210,442 I334F possibly damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Cntn3 T A 6: 102,278,353 T195S probably benign Het
Csmd2 C A 4: 128,548,819 H3221Q probably benign Het
Cyp2c68 T C 19: 39,699,284 D423G possibly damaging Het
Dennd3 C T 15: 73,547,448 T696M probably benign Het
Ep300 T C 15: 81,648,854 M1704T unknown Het
Exoc2 A G 13: 30,864,856 F738S probably damaging Het
Fis1 A G 5: 136,965,566 E36G probably damaging Het
Galnt1 A G 18: 24,267,547 I237V probably benign Het
Gspt1 A T 16: 11,230,510 I416N probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hykk G A 9: 54,946,066 C224Y probably damaging Het
Ifi211 T C 1: 173,906,263 T111A probably benign Het
Il17rd T C 14: 27,095,911 Y186H probably damaging Het
Klhl29 G T 12: 5,091,366 N539K probably benign Het
Lmbr1l T C 15: 98,909,262 T213A probably damaging Het
Madd C T 2: 91,154,514 R1318Q probably damaging Het
Mecom C A 3: 29,997,721 A182S probably benign Het
Olfr1305 C T 2: 111,873,292 A188T probably damaging Het
Olfr20 C T 11: 73,353,806 P18S probably benign Het
Olfr272 C A 4: 52,910,991 A268S probably benign Het
Olfr67 A T 7: 103,787,374 V301E probably damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
Pdia5 A G 16: 35,453,536 V130A probably damaging Het
Phldb2 T A 16: 45,825,612 H202L possibly damaging Het
Ppig G A 2: 69,735,897 G136E probably null Het
Prr14l C A 5: 32,827,777 R1458L probably damaging Het
Ptprr T C 10: 116,188,330 V182A possibly damaging Het
Rai14 A G 15: 10,574,938 Y645H probably damaging Het
Rasgrp3 T C 17: 75,497,047 I115T probably benign Het
Rc3h1 G T 1: 160,964,963 R990L possibly damaging Het
Rdh5 T A 10: 128,918,291 Q21L probably benign Het
Rfx8 A G 1: 39,710,156 probably null Het
Scap A G 9: 110,374,182 probably null Het
Shank1 T A 7: 44,351,822 S988R unknown Het
Slc16a14 T A 1: 84,907,424 I465F probably damaging Het
Slc41a2 A G 10: 83,281,368 probably null Het
Tab2 T C 10: 7,919,821 H225R possibly damaging Het
Tbx19 T A 1: 165,160,372 N64I probably damaging Het
Tmprss11f A T 5: 86,530,106 I268K probably damaging Het
Tox2 A G 2: 163,320,373 M388V probably benign Het
Trbv17 T C 6: 41,163,538 L109P probably damaging Het
Trim72 A G 7: 128,009,923 H299R probably damaging Het
Vmn1r63 C T 7: 5,803,190 V148I possibly damaging Het
Zfp938 A C 10: 82,225,258 H509Q possibly damaging Het
Zfyve16 A G 13: 92,521,231 V724A probably benign Het
Zscan10 T C 17: 23,610,421 F569L probably damaging Het
Other mutations in Ptpn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Ptpn3 APN 4 57270050 missense possibly damaging 0.95
IGL01090:Ptpn3 APN 4 57240833 missense probably damaging 1.00
IGL01399:Ptpn3 APN 4 57225775 missense probably benign 0.01
IGL01413:Ptpn3 APN 4 57270156 missense probably damaging 0.96
IGL01418:Ptpn3 APN 4 57270156 missense probably damaging 0.96
IGL01806:Ptpn3 APN 4 57254915 critical splice donor site probably null
IGL01933:Ptpn3 APN 4 57197576 missense probably benign 0.00
IGL02087:Ptpn3 APN 4 57222019 missense probably damaging 1.00
IGL02269:Ptpn3 APN 4 57197510 missense possibly damaging 0.72
IGL02413:Ptpn3 APN 4 57205020 missense probably damaging 1.00
IGL03163:Ptpn3 APN 4 57222020 missense probably damaging 1.00
R0179:Ptpn3 UTSW 4 57270118 missense probably benign 0.00
R0240:Ptpn3 UTSW 4 57232374 missense probably benign
R0240:Ptpn3 UTSW 4 57232374 missense probably benign
R0310:Ptpn3 UTSW 4 57204958 missense probably benign 0.00
R0492:Ptpn3 UTSW 4 57194304 missense probably benign
R0631:Ptpn3 UTSW 4 57204921 missense probably damaging 0.99
R0656:Ptpn3 UTSW 4 57270075 missense probably benign 0.41
R1443:Ptpn3 UTSW 4 57225775 missense probably benign 0.01
R1741:Ptpn3 UTSW 4 57254922 missense probably damaging 1.00
R1856:Ptpn3 UTSW 4 57239682 missense probably damaging 1.00
R3753:Ptpn3 UTSW 4 57270144 missense probably damaging 1.00
R4431:Ptpn3 UTSW 4 57235355 missense probably damaging 0.97
R4704:Ptpn3 UTSW 4 57270119 missense possibly damaging 0.79
R4935:Ptpn3 UTSW 4 57197568 missense probably damaging 1.00
R5119:Ptpn3 UTSW 4 57218513 missense possibly damaging 0.93
R5554:Ptpn3 UTSW 4 57240843 missense probably damaging 0.99
R6024:Ptpn3 UTSW 4 57248653 splice site probably null
R6061:Ptpn3 UTSW 4 57248681 missense probably damaging 1.00
R6212:Ptpn3 UTSW 4 57270070 missense probably damaging 1.00
R6213:Ptpn3 UTSW 4 57265012 missense probably damaging 1.00
R6239:Ptpn3 UTSW 4 57249981 missense probably benign
R6444:Ptpn3 UTSW 4 57195730 missense possibly damaging 0.51
R6606:Ptpn3 UTSW 4 57265104 splice site probably null
R6656:Ptpn3 UTSW 4 57205905 missense probably damaging 0.99
R6730:Ptpn3 UTSW 4 57270088 missense probably benign
R7133:Ptpn3 UTSW 4 57225863 missense probably benign 0.30
R7231:Ptpn3 UTSW 4 57245062 missense probably damaging 1.00
R7237:Ptpn3 UTSW 4 57239625 missense probably damaging 1.00
R7368:Ptpn3 UTSW 4 57221993 missense probably damaging 1.00
R7604:Ptpn3 UTSW 4 57240845 missense probably damaging 0.99
R7742:Ptpn3 UTSW 4 57265092 critical splice acceptor site probably null
R8023:Ptpn3 UTSW 4 57248688 missense probably benign 0.02
R8099:Ptpn3 UTSW 4 57204985 nonsense probably null
R8155:Ptpn3 UTSW 4 57232336 missense probably benign
R8302:Ptpn3 UTSW 4 57218514 missense probably benign 0.01
R8315:Ptpn3 UTSW 4 57270063 missense possibly damaging 0.88
R8335:Ptpn3 UTSW 4 57235286 missense probably damaging 0.99
R8346:Ptpn3 UTSW 4 57225547 missense probably damaging 0.99
R8348:Ptpn3 UTSW 4 57240784 critical splice donor site probably null
R8448:Ptpn3 UTSW 4 57240784 critical splice donor site probably null
R8513:Ptpn3 UTSW 4 57270085 nonsense probably null
R8846:Ptpn3 UTSW 4 57205020 missense probably damaging 1.00
R9244:Ptpn3 UTSW 4 57254915 critical splice donor site probably null
R9337:Ptpn3 UTSW 4 57218521 missense probably damaging 0.96
R9478:Ptpn3 UTSW 4 57197573 missense probably damaging 1.00
R9500:Ptpn3 UTSW 4 57205914 missense possibly damaging 0.83
R9710:Ptpn3 UTSW 4 57249957 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTTCCAGCCCTGAGACTCATG -3'
(R):5'- ACTCACTGCTCTGTCACATTATGG -3'

Sequencing Primer
(F):5'- GAGACTCATGTTCCCCAATGG -3'
(R):5'- CCAGTGAACAGTCTAACG -3'
Posted On 2016-09-01