Mutagenetix > Incidental Mutation

Incidental Mutation 'R5410:Ptpn3'

426487

Institutional Source

Beutler Lab

Gene Symbol

Ptpn3

Ensembl Gene

ENSMUSG00000038764

Gene Name

protein tyrosine phosphatase, non-receptor type 3

Synonyms

9530011I20Rik, PTPCL, PTP-H1

MMRRC Submission

042979-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.667) question?

Stock #

R5410 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

57190841-57301837 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57205019 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 714 (Y714C)

Ref Sequence

ENSEMBL: ENSMUSP00000075063 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075637]

AlphaFold

A2ALK8

Predicted Effect

probably damaging
Transcript: ENSMUST00000075637
AA Change: Y714C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000075063
Gene: ENSMUSG00000038764
AA Change: Y714C

Domain	Start	End	E-Value	Type
B41	25	222	2.44e-67	SMART
FERM_C	226	316	2.64e-25	SMART
low complexity region	454	470	N/A	INTRINSIC
PDZ	519	598	1.65e-15	SMART
PTPc	645	903	5.66e-117	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This protein contains a C-terminal PTP domain and an N-terminal domain homologous to the band 4.1 superfamily of cytoskeletal-associated proteins. P97, a cell cycle regulator involved in a variety of membrane related functions, has been shown to be a substrate of this PTP. This PTP was also found to interact with, and be regulated by adaptor protein 14-3-3 beta. Several alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit increased body weight, especially in males, and male mice exhibit increased bone mineral content. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,126,473		noncoding transcript	Het
Adam24	A	G	8: 40,681,064	M524V	probably benign	Het
Adamts20	T	A	15: 94,281,957	N1788I	possibly damaging	Het
Arfgef3	T	G	10: 18,611,237	I1350L	probably damaging	Het
Arhgap17	A	G	7: 123,297,493		probably null	Het
Ascl5	A	T	1: 136,051,188	I129F	probably damaging	Het
AU040320	A	T	4: 126,823,716	H362L	possibly damaging	Het
Bpifb9a	A	T	2: 154,270,235	N564Y	probably benign	Het
Cdon	G	T	9: 35,470,035	D574Y	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Ces1e	T	A	8: 93,210,442	I334F	possibly damaging	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Cntn3	T	A	6: 102,278,353	T195S	probably benign	Het
Csmd2	C	A	4: 128,548,819	H3221Q	probably benign	Het
Cyp2c68	T	C	19: 39,699,284	D423G	possibly damaging	Het
Dennd3	C	T	15: 73,547,448	T696M	probably benign	Het
Ep300	T	C	15: 81,648,854	M1704T	unknown	Het
Exoc2	A	G	13: 30,864,856	F738S	probably damaging	Het
Fis1	A	G	5: 136,965,566	E36G	probably damaging	Het
Galnt1	A	G	18: 24,267,547	I237V	probably benign	Het
Gspt1	A	T	16: 11,230,510	I416N	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hykk	G	A	9: 54,946,066	C224Y	probably damaging	Het
Ifi211	T	C	1: 173,906,263	T111A	probably benign	Het
Il17rd	T	C	14: 27,095,911	Y186H	probably damaging	Het
Klhl29	G	T	12: 5,091,366	N539K	probably benign	Het
Lmbr1l	T	C	15: 98,909,262	T213A	probably damaging	Het
Madd	C	T	2: 91,154,514	R1318Q	probably damaging	Het
Mecom	C	A	3: 29,997,721	A182S	probably benign	Het
Olfr1305	C	T	2: 111,873,292	A188T	probably damaging	Het
Olfr20	C	T	11: 73,353,806	P18S	probably benign	Het
Olfr272	C	A	4: 52,910,991	A268S	probably benign	Het
Olfr67	A	T	7: 103,787,374	V301E	probably damaging	Het
Otud4	T	A	8: 79,672,997	M780K	probably benign	Het
Pdia5	A	G	16: 35,453,536	V130A	probably damaging	Het
Phldb2	T	A	16: 45,825,612	H202L	possibly damaging	Het
Ppig	G	A	2: 69,735,897	G136E	probably null	Het
Prr14l	C	A	5: 32,827,777	R1458L	probably damaging	Het
Ptprr	T	C	10: 116,188,330	V182A	possibly damaging	Het
Rai14	A	G	15: 10,574,938	Y645H	probably damaging	Het
Rasgrp3	T	C	17: 75,497,047	I115T	probably benign	Het
Rc3h1	G	T	1: 160,964,963	R990L	possibly damaging	Het
Rdh5	T	A	10: 128,918,291	Q21L	probably benign	Het
Rfx8	A	G	1: 39,710,156		probably null	Het
Scap	A	G	9: 110,374,182		probably null	Het
Shank1	T	A	7: 44,351,822	S988R	unknown	Het
Slc16a14	T	A	1: 84,907,424	I465F	probably damaging	Het
Slc41a2	A	G	10: 83,281,368		probably null	Het
Tab2	T	C	10: 7,919,821	H225R	possibly damaging	Het
Tbx19	T	A	1: 165,160,372	N64I	probably damaging	Het
Tmprss11f	A	T	5: 86,530,106	I268K	probably damaging	Het
Tox2	A	G	2: 163,320,373	M388V	probably benign	Het
Trbv17	T	C	6: 41,163,538	L109P	probably damaging	Het
Trim72	A	G	7: 128,009,923	H299R	probably damaging	Het
Vmn1r63	C	T	7: 5,803,190	V148I	possibly damaging	Het
Zfp938	A	C	10: 82,225,258	H509Q	possibly damaging	Het
Zfyve16	A	G	13: 92,521,231	V724A	probably benign	Het
Zscan10	T	C	17: 23,610,421	F569L	probably damaging	Het

Other mutations in Ptpn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00905:Ptpn3	APN	4	57270050	missense	possibly damaging	0.95
IGL01090:Ptpn3	APN	4	57240833	missense	probably damaging	1.00
IGL01399:Ptpn3	APN	4	57225775	missense	probably benign	0.01
IGL01413:Ptpn3	APN	4	57270156	missense	probably damaging	0.96
IGL01418:Ptpn3	APN	4	57270156	missense	probably damaging	0.96
IGL01806:Ptpn3	APN	4	57254915	critical splice donor site	probably null
IGL01933:Ptpn3	APN	4	57197576	missense	probably benign	0.00
IGL02087:Ptpn3	APN	4	57222019	missense	probably damaging	1.00
IGL02269:Ptpn3	APN	4	57197510	missense	possibly damaging	0.72
IGL02413:Ptpn3	APN	4	57205020	missense	probably damaging	1.00
IGL03163:Ptpn3	APN	4	57222020	missense	probably damaging	1.00
R0179:Ptpn3	UTSW	4	57270118	missense	probably benign	0.00
R0240:Ptpn3	UTSW	4	57232374	missense	probably benign
R0240:Ptpn3	UTSW	4	57232374	missense	probably benign
R0310:Ptpn3	UTSW	4	57204958	missense	probably benign	0.00
R0492:Ptpn3	UTSW	4	57194304	missense	probably benign
R0631:Ptpn3	UTSW	4	57204921	missense	probably damaging	0.99
R0656:Ptpn3	UTSW	4	57270075	missense	probably benign	0.41
R1443:Ptpn3	UTSW	4	57225775	missense	probably benign	0.01
R1741:Ptpn3	UTSW	4	57254922	missense	probably damaging	1.00
R1856:Ptpn3	UTSW	4	57239682	missense	probably damaging	1.00
R3753:Ptpn3	UTSW	4	57270144	missense	probably damaging	1.00
R4431:Ptpn3	UTSW	4	57235355	missense	probably damaging	0.97
R4704:Ptpn3	UTSW	4	57270119	missense	possibly damaging	0.79
R4935:Ptpn3	UTSW	4	57197568	missense	probably damaging	1.00
R5119:Ptpn3	UTSW	4	57218513	missense	possibly damaging	0.93
R5554:Ptpn3	UTSW	4	57240843	missense	probably damaging	0.99
R6024:Ptpn3	UTSW	4	57248653	splice site	probably null
R6061:Ptpn3	UTSW	4	57248681	missense	probably damaging	1.00
R6212:Ptpn3	UTSW	4	57270070	missense	probably damaging	1.00
R6213:Ptpn3	UTSW	4	57265012	missense	probably damaging	1.00
R6239:Ptpn3	UTSW	4	57249981	missense	probably benign
R6444:Ptpn3	UTSW	4	57195730	missense	possibly damaging	0.51
R6606:Ptpn3	UTSW	4	57265104	splice site	probably null
R6656:Ptpn3	UTSW	4	57205905	missense	probably damaging	0.99
R6730:Ptpn3	UTSW	4	57270088	missense	probably benign
R7133:Ptpn3	UTSW	4	57225863	missense	probably benign	0.30
R7231:Ptpn3	UTSW	4	57245062	missense	probably damaging	1.00
R7237:Ptpn3	UTSW	4	57239625	missense	probably damaging	1.00
R7368:Ptpn3	UTSW	4	57221993	missense	probably damaging	1.00
R7604:Ptpn3	UTSW	4	57240845	missense	probably damaging	0.99
R7742:Ptpn3	UTSW	4	57265092	critical splice acceptor site	probably null
R8023:Ptpn3	UTSW	4	57248688	missense	probably benign	0.02
R8099:Ptpn3	UTSW	4	57204985	nonsense	probably null
R8155:Ptpn3	UTSW	4	57232336	missense	probably benign
R8302:Ptpn3	UTSW	4	57218514	missense	probably benign	0.01
R8315:Ptpn3	UTSW	4	57270063	missense	possibly damaging	0.88
R8335:Ptpn3	UTSW	4	57235286	missense	probably damaging	0.99
R8346:Ptpn3	UTSW	4	57225547	missense	probably damaging	0.99
R8348:Ptpn3	UTSW	4	57240784	critical splice donor site	probably null
R8448:Ptpn3	UTSW	4	57240784	critical splice donor site	probably null
R8513:Ptpn3	UTSW	4	57270085	nonsense	probably null
R8846:Ptpn3	UTSW	4	57205020	missense	probably damaging	1.00
R9244:Ptpn3	UTSW	4	57254915	critical splice donor site	probably null
R9337:Ptpn3	UTSW	4	57218521	missense	probably damaging	0.96
R9478:Ptpn3	UTSW	4	57197573	missense	probably damaging	1.00
R9500:Ptpn3	UTSW	4	57205914	missense	possibly damaging	0.83
R9710:Ptpn3	UTSW	4	57249957	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TTTCCAGCCCTGAGACTCATG -3'
(R):5'- ACTCACTGCTCTGTCACATTATGG -3'

Sequencing Primer
(F):5'- GAGACTCATGTTCCCCAATGG -3'
(R):5'- CCAGTGAACAGTCTAACG -3'

Posted On

2016-09-01