Incidental Mutation 'R5410:Csmd2'
ID426490
Institutional Source Beutler Lab
Gene Symbol Csmd2
Ensembl Gene ENSMUSG00000028804
Gene NameCUB and Sushi multiple domains 2
Synonyms
MMRRC Submission 042979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R5410 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location127987857-128567656 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 128548819 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 3221 (H3221Q)
Ref Sequence ENSEMBL: ENSMUSP00000138958 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139561
Predicted Effect probably benign
Transcript: ENSMUST00000184063
AA Change: H3221Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000221199
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,126,473 noncoding transcript Het
Adam24 A G 8: 40,681,064 M524V probably benign Het
Adamts20 T A 15: 94,281,957 N1788I possibly damaging Het
Arfgef3 T G 10: 18,611,237 I1350L probably damaging Het
Arhgap17 A G 7: 123,297,493 probably null Het
Ascl5 A T 1: 136,051,188 I129F probably damaging Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bpifb9a A T 2: 154,270,235 N564Y probably benign Het
Cdon G T 9: 35,470,035 D574Y probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Ces1e T A 8: 93,210,442 I334F possibly damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Cntn3 T A 6: 102,278,353 T195S probably benign Het
Cyp2c68 T C 19: 39,699,284 D423G possibly damaging Het
Dennd3 C T 15: 73,547,448 T696M probably benign Het
Ep300 T C 15: 81,648,854 M1704T unknown Het
Exoc2 A G 13: 30,864,856 F738S probably damaging Het
Fis1 A G 5: 136,965,566 E36G probably damaging Het
Galnt1 A G 18: 24,267,547 I237V probably benign Het
Gspt1 A T 16: 11,230,510 I416N probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hykk G A 9: 54,946,066 C224Y probably damaging Het
Ifi211 T C 1: 173,906,263 T111A probably benign Het
Il17rd T C 14: 27,095,911 Y186H probably damaging Het
Klhl29 G T 12: 5,091,366 N539K probably benign Het
Lmbr1l T C 15: 98,909,262 T213A probably damaging Het
Madd C T 2: 91,154,514 R1318Q probably damaging Het
Mecom C A 3: 29,997,721 A182S probably benign Het
Olfr1305 C T 2: 111,873,292 A188T probably damaging Het
Olfr20 C T 11: 73,353,806 P18S probably benign Het
Olfr272 C A 4: 52,910,991 A268S probably benign Het
Olfr67 A T 7: 103,787,374 V301E probably damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
Pdia5 A G 16: 35,453,536 V130A probably damaging Het
Phldb2 T A 16: 45,825,612 H202L possibly damaging Het
Ppig G A 2: 69,735,897 G136E probably null Het
Prr14l C A 5: 32,827,777 R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 Y714C probably damaging Het
Ptprr T C 10: 116,188,330 V182A possibly damaging Het
Rai14 A G 15: 10,574,938 Y645H probably damaging Het
Rasgrp3 T C 17: 75,497,047 I115T probably benign Het
Rc3h1 G T 1: 160,964,963 R990L possibly damaging Het
Rdh5 T A 10: 128,918,291 Q21L probably benign Het
Rfx8 A G 1: 39,710,156 probably null Het
Scap A G 9: 110,374,182 probably null Het
Shank1 T A 7: 44,351,822 S988R unknown Het
Slc16a14 T A 1: 84,907,424 I465F probably damaging Het
Slc41a2 A G 10: 83,281,368 probably null Het
Tab2 T C 10: 7,919,821 H225R possibly damaging Het
Tbx19 T A 1: 165,160,372 N64I probably damaging Het
Tmprss11f A T 5: 86,530,106 I268K probably damaging Het
Tox2 A G 2: 163,320,373 M388V probably benign Het
Trbv17 T C 6: 41,163,538 L109P probably damaging Het
Trim72 A G 7: 128,009,923 H299R probably damaging Het
Vmn1r63 C T 7: 5,803,190 V148I possibly damaging Het
Zfp938 A C 10: 82,225,258 H509Q possibly damaging Het
Zfyve16 A G 13: 92,521,231 V724A probably benign Het
Zscan10 T C 17: 23,610,421 F569L probably damaging Het
Other mutations in Csmd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00519:Csmd2 APN 4 128483473 missense probably benign 0.03
IGL01098:Csmd2 APN 4 128059052 missense probably damaging 0.99
IGL01114:Csmd2 APN 4 128369130 missense probably benign 0.04
IGL01364:Csmd2 APN 4 128414288 missense probably benign 0.01
IGL01530:Csmd2 APN 4 128414301 missense possibly damaging 0.66
IGL01582:Csmd2 APN 4 128563305 nonsense probably null
IGL01670:Csmd2 APN 4 128513371 splice site probably benign
IGL01707:Csmd2 APN 4 128383005 missense possibly damaging 0.81
IGL01810:Csmd2 APN 4 128480845 splice site probably benign
IGL01837:Csmd2 APN 4 128419570 missense possibly damaging 0.92
IGL01924:Csmd2 APN 4 128559947 missense unknown
IGL02013:Csmd2 APN 4 128321323 missense possibly damaging 0.47
IGL02020:Csmd2 APN 4 128559879 missense probably damaging 1.00
IGL02037:Csmd2 APN 4 128477470 splice site probably benign
IGL02303:Csmd2 APN 4 128369008 missense probably benign 0.01
IGL02317:Csmd2 APN 4 128463727 splice site probably benign
IGL02322:Csmd2 APN 4 128463727 splice site probably benign
IGL02338:Csmd2 APN 4 128395066 missense possibly damaging 0.79
IGL02412:Csmd2 APN 4 128513372 splice site probably benign
IGL02428:Csmd2 APN 4 128474816 missense possibly damaging 0.82
IGL02491:Csmd2 APN 4 128534257 missense probably benign
IGL02701:Csmd2 APN 4 128496141 missense probably benign 0.17
IGL02801:Csmd2 APN 4 128552075 splice site probably null
IGL02818:Csmd2 APN 4 128209728 missense probably damaging 1.00
IGL02863:Csmd2 APN 4 128521884 missense probably benign 0.00
IGL02876:Csmd2 APN 4 128321335 nonsense probably null
IGL02977:Csmd2 APN 4 128493276 nonsense probably null
IGL03006:Csmd2 APN 4 128480765 splice site probably benign
IGL03032:Csmd2 APN 4 128519041 missense probably benign 0.03
IGL03148:Csmd2 APN 4 128384269 missense probably damaging 1.00
IGL03157:Csmd2 APN 4 128414299 nonsense probably null
IGL03245:Csmd2 APN 4 128509122 missense probably benign 0.12
IGL03376:Csmd2 APN 4 128517671 missense probably benign 0.03
IGL03014:Csmd2 UTSW 4 128296429 missense probably benign 0.01
R0109:Csmd2 UTSW 4 128544743 missense probably benign 0.03
R0112:Csmd2 UTSW 4 128496029 missense probably damaging 1.00
R0157:Csmd2 UTSW 4 128521911 missense probably benign 0.02
R0390:Csmd2 UTSW 4 128133673 intron probably benign
R0441:Csmd2 UTSW 4 128520230 missense probably benign 0.00
R0519:Csmd2 UTSW 4 128487005 missense possibly damaging 0.95
R0743:Csmd2 UTSW 4 128113676 missense probably benign 0.00
R0746:Csmd2 UTSW 4 128414297 missense probably damaging 1.00
R0973:Csmd2 UTSW 4 128496188 missense possibly damaging 0.91
R1019:Csmd2 UTSW 4 128522014 missense probably benign 0.00
R1476:Csmd2 UTSW 4 128487001 missense probably benign 0.08
R1641:Csmd2 UTSW 4 128483395 missense possibly damaging 0.68
R1709:Csmd2 UTSW 4 128496195 missense probably damaging 0.96
R2866:Csmd2 UTSW 4 128414392 critical splice donor site probably null
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2870:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2871:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2872:Csmd2 UTSW 4 128557718 missense unknown
R2873:Csmd2 UTSW 4 128557718 missense unknown
R2893:Csmd2 UTSW 4 128538993 intron probably null
R3796:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3797:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3798:Csmd2 UTSW 4 128517595 missense probably benign 0.20
R3914:Csmd2 UTSW 4 128321324 missense probably benign 0.07
R4198:Csmd2 UTSW 4 128510924 missense probably benign 0.07
R4489:Csmd2 UTSW 4 128381945 missense possibly damaging 0.68
R4571:Csmd2 UTSW 4 128480095 splice site probably null
R4581:Csmd2 UTSW 4 128369088 missense probably benign 0.02
R4599:Csmd2 UTSW 4 127988128 missense probably benign 0.35
R4649:Csmd2 UTSW 4 128546073 missense probably benign
R4706:Csmd2 UTSW 4 128544751 missense probably benign
R4776:Csmd2 UTSW 4 128442892 missense probably benign 0.09
R4838:Csmd2 UTSW 4 128517749 missense probably benign
R4900:Csmd2 UTSW 4 128452525 missense probably benign 0.03
R4999:Csmd2 UTSW 4 128521930 missense probably benign 0.00
R5024:Csmd2 UTSW 4 128321348 missense possibly damaging 0.94
R5034:Csmd2 UTSW 4 128059108 missense probably damaging 0.98
R5152:Csmd2 UTSW 4 128552035 missense probably benign 0.27
R5172:Csmd2 UTSW 4 128477397 missense probably benign 0.10
R5231:Csmd2 UTSW 4 128546049 missense probably benign 0.00
R5279:Csmd2 UTSW 4 128456914 missense probably benign 0.30
R5287:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5403:Csmd2 UTSW 4 128486884 missense probably benign 0.01
R5551:Csmd2 UTSW 4 128510948 missense possibly damaging 0.83
R5566:Csmd2 UTSW 4 128462889 critical splice donor site probably null
R5826:Csmd2 UTSW 4 128519199 splice site probably null
R5907:Csmd2 UTSW 4 128197385 missense probably damaging 0.99
R5913:Csmd2 UTSW 4 128551988 missense probably benign 0.01
R5970:Csmd2 UTSW 4 128546151 missense probably benign 0.00
R5977:Csmd2 UTSW 4 128059034 missense probably damaging 1.00
R6027:Csmd2 UTSW 4 128559946 missense unknown
R6075:Csmd2 UTSW 4 128486865 missense probably benign 0.15
R6129:Csmd2 UTSW 4 128493334 missense possibly damaging 0.79
R6363:Csmd2 UTSW 4 128400379 missense probably benign 0.00
R6366:Csmd2 UTSW 4 128483452 missense probably benign 0.00
R6404:Csmd2 UTSW 4 128521950 missense possibly damaging 0.90
R6437:Csmd2 UTSW 4 127988100 missense probably benign 0.24
R6441:Csmd2 UTSW 4 128394964 missense probably benign 0.03
R6643:Csmd2 UTSW 4 128372597 missense probably benign 0.14
R6724:Csmd2 UTSW 4 128563371 missense probably damaging 0.97
R6734:Csmd2 UTSW 4 128463813 missense probably benign 0.00
R6750:Csmd2 UTSW 4 128197225 missense possibly damaging 0.91
R6801:Csmd2 UTSW 4 128383950 missense probably benign 0.11
R6842:Csmd2 UTSW 4 128509159 missense possibly damaging 0.72
R6843:Csmd2 UTSW 4 128463794 missense probably benign 0.27
R6868:Csmd2 UTSW 4 128442840 missense probably benign
R6882:Csmd2 UTSW 4 128449269 missense probably benign 0.01
R7019:Csmd2 UTSW 4 128369063 missense
R7028:Csmd2 UTSW 4 128277228 missense
R7096:Csmd2 UTSW 4 128462726 missense
R7122:Csmd2 UTSW 4 128449227 missense
R7125:Csmd2 UTSW 4 128496162 missense
R7197:Csmd2 UTSW 4 128511033 missense
R7234:Csmd2 UTSW 4 128456779 missense
R7299:Csmd2 UTSW 4 128528262 missense
R7301:Csmd2 UTSW 4 128528262 missense
R7319:Csmd2 UTSW 4 128393679 missense
R7331:Csmd2 UTSW 4 128564228 splice site probably null
R7332:Csmd2 UTSW 4 128419567 missense
R7352:Csmd2 UTSW 4 128557636 missense
R7402:Csmd2 UTSW 4 128322095 missense
R7402:Csmd2 UTSW 4 128322096 missense
R7474:Csmd2 UTSW 4 128546127 missense
R7555:Csmd2 UTSW 4 128452458 missense
R7592:Csmd2 UTSW 4 128463798 missense
R7700:Csmd2 UTSW 4 128545756 intron probably null
R7714:Csmd2 UTSW 4 128382950 nonsense probably null
R7734:Csmd2 UTSW 4 128552057 missense
R7735:Csmd2 UTSW 4 128456930 critical splice donor site probably null
R7757:Csmd2 UTSW 4 128483456 missense
R7805:Csmd2 UTSW 4 128419573 missense
R7823:Csmd2 UTSW 4 128209905 missense
R7904:Csmd2 UTSW 4 128419553 missense
R7946:Csmd2 UTSW 4 128520265 missense
R7964:Csmd2 UTSW 4 128523510 missense
R7968:Csmd2 UTSW 4 128197325 missense
R8003:Csmd2 UTSW 4 128539187 nonsense probably null
R8071:Csmd2 UTSW 4 128393538 missense
Z1177:Csmd2 UTSW 4 128530797 missense
Predicted Primers PCR Primer
(F):5'- GTGCACTGTCATTTCAATGGC -3'
(R):5'- AGTGAAGGACCTTGTCTCCAC -3'

Sequencing Primer
(F):5'- TGGGAACAAAACTCAGGTCTTC -3'
(R):5'- TGTCTCCACAAGTGAGACTATG -3'
Posted On2016-09-01