Incidental Mutation 'R5410:Tmprss11f'
ID 426494
Institutional Source Beutler Lab
Gene Symbol Tmprss11f
Ensembl Gene ENSMUSG00000048764
Gene Name transmembrane protease, serine 11f
Synonyms 4732406D01Rik
MMRRC Submission 042979-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 86521898-86632424 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 86530106 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 268 (I268K)
Ref Sequence ENSEMBL: ENSMUSP00000112252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000116553]
AlphaFold Q8BHM9
Predicted Effect probably damaging
Transcript: ENSMUST00000116553
AA Change: I268K

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112252
Gene: ENSMUSG00000048764
AA Change: I268K

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
SEA 56 168 4.62e-2 SMART
low complexity region 192 203 N/A INTRINSIC
Tryp_SPc 206 433 8.7e-84 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik G A 10: 3,126,473 noncoding transcript Het
Adam24 A G 8: 40,681,064 M524V probably benign Het
Adamts20 T A 15: 94,281,957 N1788I possibly damaging Het
Arfgef3 T G 10: 18,611,237 I1350L probably damaging Het
Arhgap17 A G 7: 123,297,493 probably null Het
Ascl5 A T 1: 136,051,188 I129F probably damaging Het
AU040320 A T 4: 126,823,716 H362L possibly damaging Het
Bpifb9a A T 2: 154,270,235 N564Y probably benign Het
Cdon G T 9: 35,470,035 D574Y probably damaging Het
Cenps C A 4: 149,130,201 probably benign Het
Ces1e T A 8: 93,210,442 I334F possibly damaging Het
Clip2 G A 5: 134,522,791 T159M possibly damaging Het
Cntn3 T A 6: 102,278,353 T195S probably benign Het
Csmd2 C A 4: 128,548,819 H3221Q probably benign Het
Cyp2c68 T C 19: 39,699,284 D423G possibly damaging Het
Dennd3 C T 15: 73,547,448 T696M probably benign Het
Ep300 T C 15: 81,648,854 M1704T unknown Het
Exoc2 A G 13: 30,864,856 F738S probably damaging Het
Fis1 A G 5: 136,965,566 E36G probably damaging Het
Galnt1 A G 18: 24,267,547 I237V probably benign Het
Gspt1 A T 16: 11,230,510 I416N probably benign Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hykk G A 9: 54,946,066 C224Y probably damaging Het
Ifi211 T C 1: 173,906,263 T111A probably benign Het
Il17rd T C 14: 27,095,911 Y186H probably damaging Het
Klhl29 G T 12: 5,091,366 N539K probably benign Het
Lmbr1l T C 15: 98,909,262 T213A probably damaging Het
Madd C T 2: 91,154,514 R1318Q probably damaging Het
Mecom C A 3: 29,997,721 A182S probably benign Het
Olfr1305 C T 2: 111,873,292 A188T probably damaging Het
Olfr20 C T 11: 73,353,806 P18S probably benign Het
Olfr272 C A 4: 52,910,991 A268S probably benign Het
Olfr67 A T 7: 103,787,374 V301E probably damaging Het
Otud4 T A 8: 79,672,997 M780K probably benign Het
Pdia5 A G 16: 35,453,536 V130A probably damaging Het
Phldb2 T A 16: 45,825,612 H202L possibly damaging Het
Ppig G A 2: 69,735,897 G136E probably null Het
Prr14l C A 5: 32,827,777 R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 Y714C probably damaging Het
Ptprr T C 10: 116,188,330 V182A possibly damaging Het
Rai14 A G 15: 10,574,938 Y645H probably damaging Het
Rasgrp3 T C 17: 75,497,047 I115T probably benign Het
Rc3h1 G T 1: 160,964,963 R990L possibly damaging Het
Rdh5 T A 10: 128,918,291 Q21L probably benign Het
Rfx8 A G 1: 39,710,156 probably null Het
Scap A G 9: 110,374,182 probably null Het
Shank1 T A 7: 44,351,822 S988R unknown Het
Slc16a14 T A 1: 84,907,424 I465F probably damaging Het
Slc41a2 A G 10: 83,281,368 probably null Het
Tab2 T C 10: 7,919,821 H225R possibly damaging Het
Tbx19 T A 1: 165,160,372 N64I probably damaging Het
Tox2 A G 2: 163,320,373 M388V probably benign Het
Trbv17 T C 6: 41,163,538 L109P probably damaging Het
Trim72 A G 7: 128,009,923 H299R probably damaging Het
Vmn1r63 C T 7: 5,803,190 V148I possibly damaging Het
Zfp938 A C 10: 82,225,258 H509Q possibly damaging Het
Zfyve16 A G 13: 92,521,231 V724A probably benign Het
Zscan10 T C 17: 23,610,421 F569L probably damaging Het
Other mutations in Tmprss11f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00777:Tmprss11f APN 5 86524065 missense probably damaging 1.00
IGL01453:Tmprss11f APN 5 86544832 nonsense probably null
IGL02406:Tmprss11f APN 5 86533666 missense probably damaging 1.00
IGL03294:Tmprss11f APN 5 86538107 missense probably damaging 1.00
R0122:Tmprss11f UTSW 5 86533625 splice site probably benign
R0322:Tmprss11f UTSW 5 86591416 missense probably benign 0.06
R0418:Tmprss11f UTSW 5 86557011 missense probably benign 0.16
R1936:Tmprss11f UTSW 5 86544864 missense probably benign 0.23
R2002:Tmprss11f UTSW 5 86539768 splice site probably benign
R2008:Tmprss11f UTSW 5 86591406 splice site probably null
R2260:Tmprss11f UTSW 5 86591410 missense probably benign 0.22
R4109:Tmprss11f UTSW 5 86529936 missense possibly damaging 0.89
R4584:Tmprss11f UTSW 5 86539694 critical splice donor site probably null
R4983:Tmprss11f UTSW 5 86537999 missense probably benign 0.06
R5034:Tmprss11f UTSW 5 86591384 intron probably benign
R5116:Tmprss11f UTSW 5 86539696 missense probably benign 0.01
R5254:Tmprss11f UTSW 5 86538033 missense probably benign 0.00
R5324:Tmprss11f UTSW 5 86556978 missense possibly damaging 0.95
R5441:Tmprss11f UTSW 5 86528203 missense probably damaging 1.00
R6143:Tmprss11f UTSW 5 86539699 missense probably benign
R6178:Tmprss11f UTSW 5 86556978 missense probably benign 0.00
R6239:Tmprss11f UTSW 5 86533777 missense probably damaging 0.99
R6447:Tmprss11f UTSW 5 86528227 missense probably damaging 1.00
R6817:Tmprss11f UTSW 5 86556934 missense probably benign
R7243:Tmprss11f UTSW 5 86530116 missense probably damaging 1.00
R7314:Tmprss11f UTSW 5 86524053 missense possibly damaging 0.55
R7623:Tmprss11f UTSW 5 86524160 missense probably damaging 1.00
R7708:Tmprss11f UTSW 5 86524169 missense probably damaging 1.00
R7776:Tmprss11f UTSW 5 86533746 missense probably benign 0.21
R7955:Tmprss11f UTSW 5 86544823 missense probably benign 0.13
R8046:Tmprss11f UTSW 5 86528273 missense probably damaging 1.00
R8147:Tmprss11f UTSW 5 86529910 missense probably damaging 1.00
R8209:Tmprss11f UTSW 5 86539707 missense probably damaging 1.00
R8219:Tmprss11f UTSW 5 86530019 missense probably damaging 1.00
R8343:Tmprss11f UTSW 5 86533807 missense probably benign 0.25
R8873:Tmprss11f UTSW 5 86544874 missense probably damaging 0.98
R8889:Tmprss11f UTSW 5 86539759 missense possibly damaging 0.86
R8892:Tmprss11f UTSW 5 86539759 missense possibly damaging 0.86
R9465:Tmprss11f UTSW 5 86538017 missense probably damaging 0.97
Z1176:Tmprss11f UTSW 5 86528195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAACACTTGTTTTCGGTGGC -3'
(R):5'- CAGAATGGGTGTTTTGATGCAAAG -3'

Sequencing Primer
(F):5'- CAATTTCATAGATGAATCTGGGAGGC -3'
(R):5'- GGTGTTTTGATGCAAAGGGAAC -3'
Posted On 2016-09-01