Mutagenetix > Incidental Mutation

Incidental Mutation 'R5410:Cntn3'

426497

Institutional Source

Beutler Lab

Gene Symbol

Cntn3

Ensembl Gene

ENSMUSG00000030075

Gene Name

contactin 3

Synonyms

Pang

MMRRC Submission

042979-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R5410 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

102162655-102573101 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 102278353 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 195 (T195S)

Ref Sequence

ENSEMBL: ENSMUSP00000145176 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032159] [ENSMUST00000203619]

AlphaFold

Q07409

Predicted Effect

probably benign
Transcript: ENSMUST00000032159
AA Change: T195S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000032159
Gene: ENSMUSG00000030075
AA Change: T195S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	1.85e-7	SMART
IG	129	217	1.82e-6	SMART
IGc2	240	304	6.8e-15	SMART
IGc2	330	393	1.74e-12	SMART
IGc2	422	486	1.53e-8	SMART
IG	506	595	5.2e-11	SMART
FN3	598	684	3.4e-13	SMART
FN3	701	787	5.36e-2	SMART
FN3	803	888	4.63e-6	SMART
FN3	903	983	1.07e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000203050

Predicted Effect

probably benign
Transcript: ENSMUST00000203619
AA Change: T195S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)

SMART Domains

Protein: ENSMUSP00000145176
Gene: ENSMUSG00000030075
AA Change: T195S

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
IGc2	41	107	1.85e-7	SMART
IG	129	217	1.82e-6	SMART
IGc2	240	304	6.8e-15	SMART
IGc2	330	393	1.74e-12	SMART
IGc2	422	486	1.53e-8	SMART
IG	506	595	5.2e-11	SMART
FN3	598	684	3.4e-13	SMART
FN3	701	787	5.36e-2	SMART
FN3	803	888	4.63e-6	SMART
FN3	903	983	1.07e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000204857

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.8%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,126,473		noncoding transcript	Het
Adam24	A	G	8: 40,681,064	M524V	probably benign	Het
Adamts20	T	A	15: 94,281,957	N1788I	possibly damaging	Het
Arfgef3	T	G	10: 18,611,237	I1350L	probably damaging	Het
Arhgap17	A	G	7: 123,297,493		probably null	Het
Ascl5	A	T	1: 136,051,188	I129F	probably damaging	Het
AU040320	A	T	4: 126,823,716	H362L	possibly damaging	Het
Bpifb9a	A	T	2: 154,270,235	N564Y	probably benign	Het
Cdon	G	T	9: 35,470,035	D574Y	probably damaging	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Ces1e	T	A	8: 93,210,442	I334F	possibly damaging	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Csmd2	C	A	4: 128,548,819	H3221Q	probably benign	Het
Cyp2c68	T	C	19: 39,699,284	D423G	possibly damaging	Het
Dennd3	C	T	15: 73,547,448	T696M	probably benign	Het
Ep300	T	C	15: 81,648,854	M1704T	unknown	Het
Exoc2	A	G	13: 30,864,856	F738S	probably damaging	Het
Fis1	A	G	5: 136,965,566	E36G	probably damaging	Het
Galnt1	A	G	18: 24,267,547	I237V	probably benign	Het
Gspt1	A	T	16: 11,230,510	I416N	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hykk	G	A	9: 54,946,066	C224Y	probably damaging	Het
Ifi211	T	C	1: 173,906,263	T111A	probably benign	Het
Il17rd	T	C	14: 27,095,911	Y186H	probably damaging	Het
Klhl29	G	T	12: 5,091,366	N539K	probably benign	Het
Lmbr1l	T	C	15: 98,909,262	T213A	probably damaging	Het
Madd	C	T	2: 91,154,514	R1318Q	probably damaging	Het
Mecom	C	A	3: 29,997,721	A182S	probably benign	Het
Olfr1305	C	T	2: 111,873,292	A188T	probably damaging	Het
Olfr20	C	T	11: 73,353,806	P18S	probably benign	Het
Olfr272	C	A	4: 52,910,991	A268S	probably benign	Het
Olfr67	A	T	7: 103,787,374	V301E	probably damaging	Het
Otud4	T	A	8: 79,672,997	M780K	probably benign	Het
Pdia5	A	G	16: 35,453,536	V130A	probably damaging	Het
Phldb2	T	A	16: 45,825,612	H202L	possibly damaging	Het
Ppig	G	A	2: 69,735,897	G136E	probably null	Het
Prr14l	C	A	5: 32,827,777	R1458L	probably damaging	Het
Ptpn3	T	C	4: 57,205,019	Y714C	probably damaging	Het
Ptprr	T	C	10: 116,188,330	V182A	possibly damaging	Het
Rai14	A	G	15: 10,574,938	Y645H	probably damaging	Het
Rasgrp3	T	C	17: 75,497,047	I115T	probably benign	Het
Rc3h1	G	T	1: 160,964,963	R990L	possibly damaging	Het
Rdh5	T	A	10: 128,918,291	Q21L	probably benign	Het
Rfx8	A	G	1: 39,710,156		probably null	Het
Scap	A	G	9: 110,374,182		probably null	Het
Shank1	T	A	7: 44,351,822	S988R	unknown	Het
Slc16a14	T	A	1: 84,907,424	I465F	probably damaging	Het
Slc41a2	A	G	10: 83,281,368		probably null	Het
Tab2	T	C	10: 7,919,821	H225R	possibly damaging	Het
Tbx19	T	A	1: 165,160,372	N64I	probably damaging	Het
Tmprss11f	A	T	5: 86,530,106	I268K	probably damaging	Het
Tox2	A	G	2: 163,320,373	M388V	probably benign	Het
Trbv17	T	C	6: 41,163,538	L109P	probably damaging	Het
Trim72	A	G	7: 128,009,923	H299R	probably damaging	Het
Vmn1r63	C	T	7: 5,803,190	V148I	possibly damaging	Het
Zfp938	A	C	10: 82,225,258	H509Q	possibly damaging	Het
Zfyve16	A	G	13: 92,521,231	V724A	probably benign	Het
Zscan10	T	C	17: 23,610,421	F569L	probably damaging	Het

Other mutations in Cntn3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Cntn3	APN	6	102420262	nonsense	probably null
IGL00706:Cntn3	APN	6	102203949	missense	probably benign	0.11
IGL01071:Cntn3	APN	6	102420251	critical splice donor site	probably null
IGL01769:Cntn3	APN	6	102208184	missense	probably damaging	1.00
IGL01995:Cntn3	APN	6	102203885	missense	probably damaging	1.00
IGL02058:Cntn3	APN	6	102199360	splice site	probably benign
IGL02736:Cntn3	APN	6	102203939	missense	probably damaging	1.00
IGL02955:Cntn3	APN	6	102278301	missense	probably damaging	1.00
IGL02971:Cntn3	APN	6	102168933	missense	probably damaging	1.00
IGL03208:Cntn3	APN	6	102187099	missense	probably damaging	0.99
P0037:Cntn3	UTSW	6	102209274	missense	probably damaging	1.00
PIT4431001:Cntn3	UTSW	6	102464566	missense	probably benign	0.22
R0314:Cntn3	UTSW	6	102420381	missense	probably damaging	1.00
R0388:Cntn3	UTSW	6	102277316	missense	probably damaging	0.96
R0483:Cntn3	UTSW	6	102203966	missense	probably damaging	1.00
R0539:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R0543:Cntn3	UTSW	6	102269090	splice site	probably benign
R0629:Cntn3	UTSW	6	102203976	missense	probably damaging	1.00
R0691:Cntn3	UTSW	6	102168947	missense	possibly damaging	0.48
R0693:Cntn3	UTSW	6	102168947	missense	possibly damaging	0.48
R0781:Cntn3	UTSW	6	102245158	missense	probably benign	0.22
R1110:Cntn3	UTSW	6	102245158	missense	probably benign	0.22
R1144:Cntn3	UTSW	6	102242126	missense	possibly damaging	0.65
R1503:Cntn3	UTSW	6	102464565	nonsense	probably null
R1640:Cntn3	UTSW	6	102242013	missense	possibly damaging	0.82
R1681:Cntn3	UTSW	6	102170668	missense	probably damaging	1.00
R1770:Cntn3	UTSW	6	102269205	missense	possibly damaging	0.49
R1782:Cntn3	UTSW	6	102273811	missense	probably damaging	0.97
R1861:Cntn3	UTSW	6	102245071	missense	probably benign	0.11
R1930:Cntn3	UTSW	6	102242053	nonsense	probably null
R2026:Cntn3	UTSW	6	102420427	missense	probably damaging	1.00
R2152:Cntn3	UTSW	6	102206537	missense	probably damaging	1.00
R2313:Cntn3	UTSW	6	102203928	missense	probably benign
R2351:Cntn3	UTSW	6	102337383	missense	possibly damaging	0.55
R3611:Cntn3	UTSW	6	102208077	missense	possibly damaging	0.77
R4349:Cntn3	UTSW	6	102199351	missense	probably damaging	1.00
R4421:Cntn3	UTSW	6	102464547	missense	probably damaging	0.97
R4513:Cntn3	UTSW	6	102168982	missense	probably benign	0.37
R4678:Cntn3	UTSW	6	102204020	missense	probably damaging	1.00
R4702:Cntn3	UTSW	6	102165331	missense	probably benign	0.37
R4720:Cntn3	UTSW	6	102242022	missense	possibly damaging	0.65
R4879:Cntn3	UTSW	6	102267428	missense	possibly damaging	0.47
R4951:Cntn3	UTSW	6	102169025	missense	possibly damaging	0.90
R5502:Cntn3	UTSW	6	102265334	missense	possibly damaging	0.58
R5852:Cntn3	UTSW	6	102420416	missense	probably damaging	1.00
R5903:Cntn3	UTSW	6	102242133	missense	probably benign	0.00
R6193:Cntn3	UTSW	6	102208131	missense	probably benign	0.31
R6258:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R6260:Cntn3	UTSW	6	102277217	critical splice donor site	probably null
R6350:Cntn3	UTSW	6	102170618	missense	probably damaging	1.00
R6490:Cntn3	UTSW	6	102278340	missense	probably damaging	0.99
R6993:Cntn3	UTSW	6	102278404	missense	probably damaging	0.98
R7064:Cntn3	UTSW	6	102273811	missense	probably damaging	0.97
R7085:Cntn3	UTSW	6	102165401	missense	possibly damaging	0.85
R7174:Cntn3	UTSW	6	102165344	missense	probably benign
R7208:Cntn3	UTSW	6	102278422	nonsense	probably null
R7395:Cntn3	UTSW	6	102337394	critical splice acceptor site	probably null
R7447:Cntn3	UTSW	6	102278455	nonsense	probably null
R7571:Cntn3	UTSW	6	102278403	missense	probably damaging	1.00
R7586:Cntn3	UTSW	6	102420427	missense	probably damaging	1.00
R7614:Cntn3	UTSW	6	102165376	missense	probably benign	0.17
R7697:Cntn3	UTSW	6	102208166	missense	probably damaging	1.00
R7697:Cntn3	UTSW	6	102208167	missense	probably damaging	1.00
R7849:Cntn3	UTSW	6	102265431	missense	probably benign	0.00
R8011:Cntn3	UTSW	6	102437899	missense	possibly damaging	0.93
R8013:Cntn3	UTSW	6	102199317	missense	probably benign	0.00
R8377:Cntn3	UTSW	6	102209293	missense	probably benign	0.00
R8726:Cntn3	UTSW	6	102169053	nonsense	probably null
R8770:Cntn3	UTSW	6	102277316	missense	possibly damaging	0.67
R8827:Cntn3	UTSW	6	102269133	missense	probably benign	0.01
R8947:Cntn3	UTSW	6	102437903	missense	probably damaging	1.00
R8997:Cntn3	UTSW	6	102204062	missense	probably damaging	0.98
R9055:Cntn3	UTSW	6	102267437	missense	probably benign	0.38
R9061:Cntn3	UTSW	6	102337327	missense	probably damaging	1.00
R9758:Cntn3	UTSW	6	102206550	missense	probably damaging	1.00
R9762:Cntn3	UTSW	6	102277235	missense	probably damaging	1.00
Z1088:Cntn3	UTSW	6	102420294	missense	possibly damaging	0.74
Z1176:Cntn3	UTSW	6	102437931	critical splice acceptor site	probably null
Z1177:Cntn3	UTSW	6	102337331	missense	probably benign	0.17

Predicted Primers

PCR Primer
(F):5'- AGGTAATGCCACAGGACTTTTC -3'
(R):5'- TTCTTCTGAATGGCTGGCAAG -3'

Sequencing Primer
(F):5'- GGTAATGCCACAGGACTTTTCTTTAC -3'
(R):5'- TCTTCTGAATGGCTGGCAAGAAAAAG -3'

Posted On

2016-09-01