Incidental Mutation 'R5410:Or52z1'
ID 426500
Institutional Source Beutler Lab
Gene Symbol Or52z1
Ensembl Gene ENSMUSG00000047535
Gene Name olfactory receptor family 52 subfamily Z member 1
Synonyms GA_x6K02T2PBJ9-6515150-6514170, Olfr67, MOR31-1, 3'[b]1
MMRRC Submission 042979-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R5410 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 103436419-103441037 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 103436581 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 301 (V301E)
Ref Sequence ENSEMBL: ENSMUSP00000138389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000183254] [ENSMUST00000183254]
AlphaFold F8VPJ8
Predicted Effect probably damaging
Transcript: ENSMUST00000183254
AA Change: V301E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138389
Gene: ENSMUSG00000047535
AA Change: V301E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 41 231 5.5e-11 PFAM
Pfam:7tm_1 47 299 2.7e-30 PFAM
Pfam:7tm_4 146 292 1.7e-29 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183254
AA Change: V301E

PolyPhen 2 Score 0.970 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000138389
Gene: ENSMUSG00000047535
AA Change: V301E

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 41 231 5.5e-11 PFAM
Pfam:7tm_1 47 299 2.7e-30 PFAM
Pfam:7tm_4 146 292 1.7e-29 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam24 A G 8: 41,134,103 (GRCm39) M524V probably benign Het
Adamts20 T A 15: 94,179,838 (GRCm39) N1788I possibly damaging Het
Arfgef3 T G 10: 18,486,985 (GRCm39) I1350L probably damaging Het
Arhgap17 A G 7: 122,896,716 (GRCm39) probably null Het
Ascl5 A T 1: 135,978,926 (GRCm39) I129F probably damaging Het
AU040320 A T 4: 126,717,509 (GRCm39) H362L possibly damaging Het
Bpifb9a A T 2: 154,112,155 (GRCm39) N564Y probably benign Het
Cdon G T 9: 35,381,331 (GRCm39) D574Y probably damaging Het
Cenps C A 4: 149,214,658 (GRCm39) probably benign Het
Ces1e T A 8: 93,937,070 (GRCm39) I334F possibly damaging Het
Clip2 G A 5: 134,551,645 (GRCm39) T159M possibly damaging Het
Cntn3 T A 6: 102,255,314 (GRCm39) T195S probably benign Het
Csmd2 C A 4: 128,442,612 (GRCm39) H3221Q probably benign Het
Cyp2c68 T C 19: 39,687,728 (GRCm39) D423G possibly damaging Het
Dennd3 C T 15: 73,419,297 (GRCm39) T696M probably benign Het
Ep300 T C 15: 81,533,055 (GRCm39) M1704T unknown Het
Exoc2 A G 13: 31,048,839 (GRCm39) F738S probably damaging Het
Fis1 A G 5: 136,994,420 (GRCm39) E36G probably damaging Het
Galnt1 A G 18: 24,400,604 (GRCm39) I237V probably benign Het
Gspt1 A T 16: 11,048,374 (GRCm39) I416N probably benign Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Hykk G A 9: 54,853,350 (GRCm39) C224Y probably damaging Het
Ifi211 T C 1: 173,733,829 (GRCm39) T111A probably benign Het
Il17rd T C 14: 26,817,868 (GRCm39) Y186H probably damaging Het
Klhl29 G T 12: 5,141,366 (GRCm39) N539K probably benign Het
Lmbr1l T C 15: 98,807,143 (GRCm39) T213A probably damaging Het
Madd C T 2: 90,984,859 (GRCm39) R1318Q probably damaging Het
Mecom C A 3: 30,051,870 (GRCm39) A182S probably benign Het
Or13c25 C A 4: 52,910,991 (GRCm39) A268S probably benign Het
Or1e1 C T 11: 73,244,632 (GRCm39) P18S probably benign Het
Or4f56 C T 2: 111,703,637 (GRCm39) A188T probably damaging Het
Otud4 T A 8: 80,399,626 (GRCm39) M780K probably benign Het
Pdia5 A G 16: 35,273,906 (GRCm39) V130A probably damaging Het
Phldb2 T A 16: 45,645,975 (GRCm39) H202L possibly damaging Het
Ppig G A 2: 69,566,241 (GRCm39) G136E probably null Het
Prr14l C A 5: 32,985,121 (GRCm39) R1458L probably damaging Het
Ptpn3 T C 4: 57,205,019 (GRCm39) Y714C probably damaging Het
Ptprr T C 10: 116,024,235 (GRCm39) V182A possibly damaging Het
Rai14 A G 15: 10,575,024 (GRCm39) Y645H probably damaging Het
Rasgrp3 T C 17: 75,804,042 (GRCm39) I115T probably benign Het
Rc3h1 G T 1: 160,792,533 (GRCm39) R990L possibly damaging Het
Rdh5 T A 10: 128,754,160 (GRCm39) Q21L probably benign Het
Rfx8 A G 1: 39,749,316 (GRCm39) probably null Het
Scap A G 9: 110,203,250 (GRCm39) probably null Het
Shank1 T A 7: 44,001,246 (GRCm39) S988R unknown Het
Slc16a14 T A 1: 84,885,145 (GRCm39) I465F probably damaging Het
Slc41a2 A G 10: 83,117,232 (GRCm39) probably null Het
Tab2 T C 10: 7,795,585 (GRCm39) H225R possibly damaging Het
Tbx19 T A 1: 164,987,941 (GRCm39) N64I probably damaging Het
Tmprss11f A T 5: 86,677,965 (GRCm39) I268K probably damaging Het
Tox2 A G 2: 163,162,293 (GRCm39) M388V probably benign Het
Trbv17 T C 6: 41,140,472 (GRCm39) L109P probably damaging Het
Trim72 A G 7: 127,609,095 (GRCm39) H299R probably damaging Het
Ulbp3 G A 10: 3,076,473 (GRCm39) noncoding transcript Het
Vmn1r63 C T 7: 5,806,189 (GRCm39) V148I possibly damaging Het
Zfp938 A C 10: 82,061,092 (GRCm39) H509Q possibly damaging Het
Zfyve16 A G 13: 92,657,739 (GRCm39) V724A probably benign Het
Zscan10 T C 17: 23,829,395 (GRCm39) F569L probably damaging Het
Other mutations in Or52z1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Or52z1 APN 7 103,436,843 (GRCm39) missense probably damaging 0.97
IGL01352:Or52z1 APN 7 103,437,285 (GRCm39) nonsense probably null 0.00
IGL02318:Or52z1 APN 7 103,437,475 (GRCm39) missense probably benign
R0413:Or52z1 UTSW 7 103,437,362 (GRCm39) missense probably damaging 1.00
R0964:Or52z1 UTSW 7 103,436,604 (GRCm39) missense probably benign 0.18
R2092:Or52z1 UTSW 7 103,437,279 (GRCm39) missense possibly damaging 0.50
R3963:Or52z1 UTSW 7 103,437,241 (GRCm39) missense probably benign 0.02
R4299:Or52z1 UTSW 7 103,437,202 (GRCm39) missense probably benign 0.38
R4799:Or52z1 UTSW 7 103,436,688 (GRCm39) missense possibly damaging 0.49
R5959:Or52z1 UTSW 7 103,436,723 (GRCm39) missense probably damaging 0.99
R6084:Or52z1 UTSW 7 103,437,162 (GRCm39) missense probably benign 0.11
R6336:Or52z1 UTSW 7 103,437,452 (GRCm39) missense possibly damaging 0.86
R7077:Or52z1 UTSW 7 103,436,593 (GRCm39) missense probably damaging 0.99
R7453:Or52z1 UTSW 7 103,436,879 (GRCm39) missense possibly damaging 0.90
R8695:Or52z1 UTSW 7 103,436,729 (GRCm39) missense possibly damaging 0.81
R8753:Or52z1 UTSW 7 103,436,567 (GRCm39) missense probably benign 0.08
R9062:Or52z1 UTSW 7 103,437,155 (GRCm39) missense probably benign 0.00
R9126:Or52z1 UTSW 7 103,437,002 (GRCm39) missense probably benign 0.27
R9741:Or52z1 UTSW 7 103,436,941 (GRCm39) missense probably benign 0.00
R9784:Or52z1 UTSW 7 103,436,732 (GRCm39) missense probably benign 0.02
Z1088:Or52z1 UTSW 7 103,436,572 (GRCm39) missense probably damaging 0.99
Z1176:Or52z1 UTSW 7 103,436,660 (GRCm39) missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- TCCTCTTGAAAGTGAAGCACTC -3'
(R):5'- CACCATGATTCTTCGCACTG -3'

Sequencing Primer
(F):5'- CTATTCTCACAGGGATGACAT -3'
(R):5'- TTCCTGGGCTGCCAGATACAAG -3'
Posted On 2016-09-01