Mutagenetix > Incidental Mutation

Incidental Mutation 'R5410:Cdon'

426507

Institutional Source

Beutler Lab

Gene Symbol

Cdon

Ensembl Gene

ENSMUSG00000038119

Gene Name

cell adhesion molecule-related/down-regulated by oncogenes

Synonyms

CDO, CAM-related/down-regulated by oncogenes

MMRRC Submission

042979-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.304) question?

Stock #

R5410 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35421128-35507652 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 35470035 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Tyrosine at position 574 (D574Y)

Ref Sequence

ENSEMBL: ENSMUSP00000117499 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000042842] [ENSMUST00000119129] [ENSMUST00000154652]

AlphaFold

Q32MD9

Predicted Effect

probably damaging
Transcript: ENSMUST00000042842
AA Change: D574Y

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000045547
Gene: ENSMUSG00000038119
AA Change: D574Y

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	40	103	1.35e-9	SMART
IG	125	212	7.25e-1	SMART
IGc2	233	296	1.38e-6	SMART
IGc2	323	386	4.62e-17	SMART
IGc2	416	506	5e-13	SMART
FN3	573	660	2.18e-2	SMART
FN3	717	800	1.89e-11	SMART
FN3	822	909	7.01e-6	SMART
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1101	1111	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000084000

Predicted Effect

probably damaging
Transcript: ENSMUST00000119129
AA Change: D574Y

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000113977
Gene: ENSMUSG00000038119
AA Change: D574Y

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	40	103	1.35e-9	SMART
IG	125	212	7.25e-1	SMART
IGc2	233	296	1.38e-6	SMART
IGc2	323	386	4.62e-17	SMART
IGc2	416	506	5e-13	SMART
FN3	573	660	2.18e-2	SMART
FN3	717	800	1.89e-11	SMART
FN3	822	909	7.01e-6	SMART
transmembrane domain	962	984	N/A	INTRINSIC
low complexity region	1101	1111	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000127264
AA Change: D201Y

SMART Domains

Protein: ENSMUSP00000115216
Gene: ENSMUSG00000038119
AA Change: D201Y

Domain	Start	End	E-Value	Type
IGc2	1	51	6.26e-5	SMART
IG_like	18	62	1.06e2	SMART
IGc2	81	134	6.45e-7	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000154652
AA Change: D574Y

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000117499
Gene: ENSMUSG00000038119
AA Change: D574Y

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
IGc2	40	103	1.35e-9	SMART
IG	125	212	7.25e-1	SMART
IGc2	233	296	1.38e-6	SMART
IGc2	323	386	4.62e-17	SMART
IGc2	416	506	5e-13	SMART
FN3	573	660	2.18e-2	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 92.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cell surface receptor that is a member of the immunoglobulin superfamily. The encoded protein contains three fibronectin type III domains and five immunoglobulin-like C2-type domains. This protein is a member of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells and positively regulates myogenesis. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous null mice display facial defects characteristic of microform holoprosencephaly, are runted, and are prone to death prior to weaning. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	G	A	10: 3,126,473		noncoding transcript	Het
Adam24	A	G	8: 40,681,064	M524V	probably benign	Het
Adamts20	T	A	15: 94,281,957	N1788I	possibly damaging	Het
Arfgef3	T	G	10: 18,611,237	I1350L	probably damaging	Het
Arhgap17	A	G	7: 123,297,493		probably null	Het
Ascl5	A	T	1: 136,051,188	I129F	probably damaging	Het
AU040320	A	T	4: 126,823,716	H362L	possibly damaging	Het
Bpifb9a	A	T	2: 154,270,235	N564Y	probably benign	Het
Cenps	C	A	4: 149,130,201		probably benign	Het
Ces1e	T	A	8: 93,210,442	I334F	possibly damaging	Het
Clip2	G	A	5: 134,522,791	T159M	possibly damaging	Het
Cntn3	T	A	6: 102,278,353	T195S	probably benign	Het
Csmd2	C	A	4: 128,548,819	H3221Q	probably benign	Het
Cyp2c68	T	C	19: 39,699,284	D423G	possibly damaging	Het
Dennd3	C	T	15: 73,547,448	T696M	probably benign	Het
Ep300	T	C	15: 81,648,854	M1704T	unknown	Het
Exoc2	A	G	13: 30,864,856	F738S	probably damaging	Het
Fis1	A	G	5: 136,965,566	E36G	probably damaging	Het
Galnt1	A	G	18: 24,267,547	I237V	probably benign	Het
Gspt1	A	T	16: 11,230,510	I416N	probably benign	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hykk	G	A	9: 54,946,066	C224Y	probably damaging	Het
Ifi211	T	C	1: 173,906,263	T111A	probably benign	Het
Il17rd	T	C	14: 27,095,911	Y186H	probably damaging	Het
Klhl29	G	T	12: 5,091,366	N539K	probably benign	Het
Lmbr1l	T	C	15: 98,909,262	T213A	probably damaging	Het
Madd	C	T	2: 91,154,514	R1318Q	probably damaging	Het
Mecom	C	A	3: 29,997,721	A182S	probably benign	Het
Olfr1305	C	T	2: 111,873,292	A188T	probably damaging	Het
Olfr20	C	T	11: 73,353,806	P18S	probably benign	Het
Olfr272	C	A	4: 52,910,991	A268S	probably benign	Het
Olfr67	A	T	7: 103,787,374	V301E	probably damaging	Het
Otud4	T	A	8: 79,672,997	M780K	probably benign	Het
Pdia5	A	G	16: 35,453,536	V130A	probably damaging	Het
Phldb2	T	A	16: 45,825,612	H202L	possibly damaging	Het
Ppig	G	A	2: 69,735,897	G136E	probably null	Het
Prr14l	C	A	5: 32,827,777	R1458L	probably damaging	Het
Ptpn3	T	C	4: 57,205,019	Y714C	probably damaging	Het
Ptprr	T	C	10: 116,188,330	V182A	possibly damaging	Het
Rai14	A	G	15: 10,574,938	Y645H	probably damaging	Het
Rasgrp3	T	C	17: 75,497,047	I115T	probably benign	Het
Rc3h1	G	T	1: 160,964,963	R990L	possibly damaging	Het
Rdh5	T	A	10: 128,918,291	Q21L	probably benign	Het
Rfx8	A	G	1: 39,710,156		probably null	Het
Scap	A	G	9: 110,374,182		probably null	Het
Shank1	T	A	7: 44,351,822	S988R	unknown	Het
Slc16a14	T	A	1: 84,907,424	I465F	probably damaging	Het
Slc41a2	A	G	10: 83,281,368		probably null	Het
Tab2	T	C	10: 7,919,821	H225R	possibly damaging	Het
Tbx19	T	A	1: 165,160,372	N64I	probably damaging	Het
Tmprss11f	A	T	5: 86,530,106	I268K	probably damaging	Het
Tox2	A	G	2: 163,320,373	M388V	probably benign	Het
Trbv17	T	C	6: 41,163,538	L109P	probably damaging	Het
Trim72	A	G	7: 128,009,923	H299R	probably damaging	Het
Vmn1r63	C	T	7: 5,803,190	V148I	possibly damaging	Het
Zfp938	A	C	10: 82,225,258	H509Q	possibly damaging	Het
Zfyve16	A	G	13: 92,521,231	V724A	probably benign	Het
Zscan10	T	C	17: 23,610,421	F569L	probably damaging	Het

Other mutations in Cdon

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00832:Cdon	APN	9	35478116	missense	probably damaging	1.00
IGL01307:Cdon	APN	9	35457564	missense	probably benign	0.01
IGL01528:Cdon	APN	9	35470107	missense	possibly damaging	0.95
IGL01663:Cdon	APN	9	35483214	missense	possibly damaging	0.57
IGL01723:Cdon	APN	9	35503338	missense	probably benign	0.05
IGL02200:Cdon	APN	9	35483109	missense	probably benign	0.28
IGL02444:Cdon	APN	9	35473448	missense	probably benign	0.09
IGL02547:Cdon	APN	9	35478654	missense	probably damaging	1.00
IGL02620:Cdon	APN	9	35452799	missense	probably benign	0.00
IGL02861:Cdon	APN	9	35486957	missense	probably damaging	0.96
IGL02894:Cdon	APN	9	35455426	missense	probably benign	0.01
IGL03153:Cdon	APN	9	35477959	missense	probably damaging	1.00
IGL03206:Cdon	APN	9	35503306	missense	probably benign
IGL03374:Cdon	APN	9	35478003	missense	possibly damaging	0.46
corleone	UTSW	9	35486956	nonsense	probably null
indentured	UTSW	9	35452106	start codon destroyed	probably null	1.00
Molar	UTSW	9	35463895	missense	probably benign	0.15
Servitude	UTSW	9	35476948	missense	probably damaging	1.00
PIT4280001:Cdon	UTSW	9	35486935	missense	probably damaging	1.00
R0045:Cdon	UTSW	9	35486807	missense	probably benign
R0045:Cdon	UTSW	9	35486807	missense	probably benign
R0064:Cdon	UTSW	9	35489227	missense	probably benign	0.03
R0396:Cdon	UTSW	9	35470130	missense	probably damaging	1.00
R0403:Cdon	UTSW	9	35473500	missense	probably benign	0.00
R0490:Cdon	UTSW	9	35452682	missense	probably damaging	1.00
R0547:Cdon	UTSW	9	35457498	missense	possibly damaging	0.88
R0609:Cdon	UTSW	9	35478611	missense	probably damaging	1.00
R0645:Cdon	UTSW	9	35477083	splice site	probably null
R0781:Cdon	UTSW	9	35456437	splice site	probably benign
R1110:Cdon	UTSW	9	35456437	splice site	probably benign
R1391:Cdon	UTSW	9	35504189	missense	possibly damaging	0.51
R1574:Cdon	UTSW	9	35452937	splice site	probably benign
R1851:Cdon	UTSW	9	35483158	missense	probably damaging	1.00
R2031:Cdon	UTSW	9	35504074	missense	probably damaging	0.96
R2230:Cdon	UTSW	9	35491926	critical splice donor site	probably null
R3683:Cdon	UTSW	9	35489032	missense	possibly damaging	0.89
R3684:Cdon	UTSW	9	35489032	missense	possibly damaging	0.89
R3685:Cdon	UTSW	9	35489032	missense	possibly damaging	0.89
R3941:Cdon	UTSW	9	35464171	missense	probably benign	0.09
R4030:Cdon	UTSW	9	35491906	missense	probably damaging	1.00
R4084:Cdon	UTSW	9	35478131	missense	probably damaging	0.98
R4462:Cdon	UTSW	9	35457580	missense	probably damaging	0.97
R4569:Cdon	UTSW	9	35476969	missense	probably damaging	1.00
R4677:Cdon	UTSW	9	35478605	missense	probably damaging	1.00
R4869:Cdon	UTSW	9	35452904	missense	possibly damaging	0.71
R5032:Cdon	UTSW	9	35489034	missense	probably damaging	1.00
R5047:Cdon	UTSW	9	35478639	missense	probably damaging	1.00
R5214:Cdon	UTSW	9	35483208	missense	probably damaging	1.00
R5341:Cdon	UTSW	9	35470135	missense	probably damaging	1.00
R5581:Cdon	UTSW	9	35504081	missense	probably benign	0.01
R5696:Cdon	UTSW	9	35491866	missense	possibly damaging	0.69
R5757:Cdon	UTSW	9	35452772	missense	probably damaging	0.98
R5802:Cdon	UTSW	9	35454420	missense	probably damaging	0.99
R5845:Cdon	UTSW	9	35457466	missense	probably damaging	1.00
R5949:Cdon	UTSW	9	35486951	missense	probably benign	0.32
R6106:Cdon	UTSW	9	35455408	nonsense	probably null
R6245:Cdon	UTSW	9	35476939	missense	probably damaging	1.00
R6845:Cdon	UTSW	9	35486956	nonsense	probably null
R6896:Cdon	UTSW	9	35452106	start codon destroyed	probably null	1.00
R7060:Cdon	UTSW	9	35486909	missense	probably damaging	1.00
R7076:Cdon	UTSW	9	35504150	missense	probably benign	0.00
R7184:Cdon	UTSW	9	35463895	missense	probably benign	0.15
R7382:Cdon	UTSW	9	35478648	missense	probably damaging	1.00
R7763:Cdon	UTSW	9	35454415	nonsense	probably null
R7857:Cdon	UTSW	9	35456612	missense	possibly damaging	0.79
R7885:Cdon	UTSW	9	35456522	missense	probably benign	0.01
R7894:Cdon	UTSW	9	35476948	missense	probably damaging	1.00
R7984:Cdon	UTSW	9	35503302	missense	probably benign	0.00
R8287:Cdon	UTSW	9	35463929	missense	probably benign
R8428:Cdon	UTSW	9	35491867	missense	probably benign	0.21
R8519:Cdon	UTSW	9	35478654	missense	probably damaging	1.00
R8698:Cdon	UTSW	9	35486973	critical splice donor site	probably null
R8797:Cdon	UTSW	9	35478635	missense	probably damaging	1.00
R8995:Cdon	UTSW	9	35486797	missense	probably damaging	1.00
R9090:Cdon	UTSW	9	35491879	missense	probably damaging	0.98
R9177:Cdon	UTSW	9	35469934	missense	probably benign	0.00
R9200:Cdon	UTSW	9	35503321	missense	probably benign	0.00
R9271:Cdon	UTSW	9	35491879	missense	probably damaging	0.98
R9330:Cdon	UTSW	9	35488979	nonsense	probably null
R9477:Cdon	UTSW	9	35491905	missense	probably damaging	1.00
R9612:Cdon	UTSW	9	35486905	missense	probably damaging	1.00
R9730:Cdon	UTSW	9	35486967	missense	probably benign	0.00
Z1177:Cdon	UTSW	9	35491900	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTGCAGTTCCTTTCGAGAC -3'
(R):5'- TGACAAACTTATTCCGGAACACTC -3'

Sequencing Primer
(F):5'- GTGCAGTTCCTTTCGAGACAAACAC -3'
(R):5'- GGAAAACATAATGAGCAAATGTCTC -3'

Posted On

2016-09-01